Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21702  (registered. 2012)
Contig Information
Length 1308 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_EM Dormant seed with water absorption 1
Wh_PCDAM Anther at meiosis 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_CA 1
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115442143|ref|NP_001045351.1|| Os01g0939700 [Oryza sativa (japonica cultivar-group)]
Score 542
Evalue 4.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21702
CTCCACCCACCACCACTCCCTCACACCCCGCCGGCGACCGCGCGATGGCGGCGGCCGCTCCCCCTCCCGCGGCGGCGCTGGAGCAGCTGAGCAAGACCAA
GATGTTCGGCGGCCACAACCTCCGCTTCCGCCACCAGAGCGCCTCGCTCGGCTGCCCCATGACCTTCTCCCTCTTCCTCCCCGCGTCCCCGGCCTCCAAG
CTCCCCGTGCTGTACTGGCTCTCCGGCCTCACCTGCACCGACGAGAACTTCATCATCAAGTCCGGCGCCCAGCGCGCCGCCGCGGCACACGGCGTCGCCC
TCGTCGCCCCCGACACCTCCCCGCGTGGACTAAATGTAGAAGGGGAGGCAGATAGTTGGGATTTTGGTGTTGGTGCTGGATTTTATTTGAATGCCACAAA
TGAGAAGTGGAAAAACTGGCGCATGTATGATTATGTTGTGAAGGAGCTGCCAAAAGTTTTAACTGACAACTTTGAACAGCTTAACACGTCATGTGCATCA
ATTTTTGGCCACTCTATGGGAGGGCACGGTGCACTGACTATCTACTTGAAGAACACTGACAAATACAAGTCGGTGTCTGCATTTGCTCCAATTGCTAACC
CAATAAACTGCCCTTGGGGTCAGAAAGCATTCTCAAACTATCTGGGCACAACTAAATCAGAATGGGAGGAATACGATGCAACCTTGTTGGTTAAGAAGTG
CAACACACTTTCAACTCCTATCCTGGTTGACCAGGGAGAGGATGACAAGTTCCTGGCGGAGCAGCTGCTGGCGGGCAACTTCGAGGAGGCGTGCAAGGCG
GCGGGCGCTCCCCTGATCCTGCGCATGCAGCCGGGATACGACCATTCCTTCTTCTTCATCGCCACCTTCATTGACGACCACATCGCGCACCACGCCCAGT
TCCTCAAGAGCGGCTGACTGGCCAGCCACCTGTAGCGAGTGATGCGATCGGTAGAAGTGCCGAGTCAGCGGCGTCGCCTGCCTCCATATACTACCATCTG
TGTTGTTATCACTTGTGTGTATGCGTCGTGTGTCGGTTGGATTGAGATGGAAATAATGTGGACGGCTTGCGGTCGTCTCTGAAGTGCGCGTGCGTGCGTG
CATGCATGCCTTGGCTGGAAATTCAGTCGGTAGAATTTGCTGGCCCTGCTGTAGTAGCATTTGAGGTTTAAAGCGTCTGTGGCAGCCTAGGCCACGGGCG
AGTAATCTTACTGTAATTCGTACAGCTACAAGGTGATACTCTCTCGAACTGATACGTGGATTAGCAGTAAACTTACTGTGTACTGCACGTTTTTCTCAAA
AAAAAAAA
page-top