Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21634  (registered. 2012)
Contig Information
Length 960 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125602450|gb|EAZ41775.1|| hypothetical protein OsJ_26316 [Oryza sativa Japonica Group]
Score 441
Evalue 6.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21634
AAAGATCATAGAAAACCACACTCCGACTACGCAAACAGATCCATCTCAGTAGTATCCATGTTCAGCGATCATAGCACATACTGTACACAGCAAGTCCCAA
GCACTCTTCTCTAACTAGGCCAATCACGGCATACGTATTCGGTGCTACAGTAGCTTTTATTTTTGTTGGCGGAGCGGTAGAGGCTGCCATTTTATTACAT
CAAAAGGCCATTGCTGCATAAGGTTTGCCTCCTCAACAACCCCTGGCCCCGGGGCCTGCTGATCTTCAGTGGAGTTCCTTGAGGAAGTCCGCATGATCCA
CCAGAACCACTTTCCAGCCATCGGGGTCAAGGAAAGAGGTGATCTTCGTGTTCAGCCCCGGTAGTGGCCCAGGCTGACGTAGGATCTTTCCACCTAGTTC
TTTGGTAACCAGCTCAACTGCTTCAGCACTCTTGTACACATCATCAGTGCCAATAGCAACCTGAGCATATGCATTGCCCTTGTTATATTCTGTGACACCA
TAGTTGTATGTCAACTCCAGAACAGTGGTCTTATCCTCCTCAGCATAGCCCATCATGGCAATAGTGTACTTGTACTGAGGCACATCCTTCTTCCTCAGAA
GCTTCATCCCAAGGGCCTTCTCGTAGAACATGATAGACCGATCAAGGTCACCAACACGAAGCATAACTTGACAGAGAGGCTCAGGCGTCGGACCCCTCTG
GATAAGCTCGAACATGTAACCATCTGGGTCTGGTGCAAAAGCAATCACAGTGGACCCTCCCTTGACAGGACCAGGTTCACGAGTGATCTTACAACATGAA
GATGATTTAATTGTCTCAGCCAGCTTGTACACATCCTCATGTGCGATGGCAAAATGTCCAAAGCCCGCTCCAATGTCATACTTGTCGACACCATAATTGT
AAGTCAGCTCAAGTGCAAAATTACTGTCCTCAGGTCCAAACCCAAGAAACGCATTGGTGT
page-top