Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21601  (registered. 2012)
Contig Information
Length 967 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125526269|gb|EAY74383.1|| hypothetical protein OsI_02273 [Oryza sativa Indica Group]
Score 466
Evalue 2.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21601
ACCTCAAGATATTCTGGCAAAACAATGACGAGTTGGAATATAGTACTACTAACACAAACACACTGCGTGTCTAGATTGGGCACTGGCTACATATTGCGCC
CAAACATTTTATTCTTCCGAGCCGACACACGCCCATACATCATTCAGAGACCATATGGAAGATATGGTAATGGCTCATGCAGATCCCAGGAAACGACCCA
TCCAAGTGGAGAAGCGGGACCATGCCAGGTCAATGGCTCCCTGATTCTCATCAGTCAAACCCATGCCCTTCCTCCTCTTGACGGCCTCAGGCGATGCGTT
CATGAAGGCATGTGAGCATCCAGGGTATATGTGGACTTCATGTGCCACTCCAGAAGCCTTGAGCTTCTCCTCCAACGACTTGGCCGCGGTAACATCTGCA
AACCCAACAAAACTGTCAAGCTCCCCAAAATGAGCCTGGATTGGAGCCTGGGCCTTGGAAGCATCAGCAAGCTCCGAAGATGGCGTCCCGTAGAAAGCAA
CAACAGCATCAACCTCTGGGACCAAAACTCCACTTGCAATTGCCAAAGCACCTCCCATGCAATAACCAGTAACACCAACCTTGGGTGATCCATTTTCCTT
CAGCCATTTAACTGAAGCCTGAATATCCTTGATTGCACCCTGCCAGTCTAGTCCTTCCATCAGATGTTGTGCTTCAGCTACCTCCAAAGCAACCTTCCCA
CGGTACAAATCTGGAATAAGTGCTCTGTATCCATCGCCGATCTGGGAAATATGGATGGCATGATTCTTGACCTCATAGTCAACACCCCACCACTCTTGCA
ACACTACAACTCCAGGAGCGTTTTCTTTGCCAACAACATAGGCATCAAACGTCGTGTCCTCGCGCTGGATCTGGATCTTCTGGAACTGGCTGGCGGCATC
GGAGGCCATGGCGGGGGGCTGGAAGCGGGACGAGTGCAGGGGCGAGCGGCGGAGGGGGAGCAGGGAG
page-top