Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21568  (registered. 2012)
Contig Information
Length 785 bp
Clones alternative view 52 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 7
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_SP 1
WH_XA Root 1
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219362517|ref|NP_001136755.1|| hypothetical protein LOC100216896 [Zea mays]
Score 293
Evalue 1.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21568
TTTTTTTTTTAAGTAACAACCATTTCATGGTTTCCATAGACTGAAAAACTAGTTTTTCGCATAAATACCACAAGTTTCTGAACCAAAAATAGGATCCACA
CAACATTCATAGTAGGACTAACAGCAAATGATCCTCAACAGAGCAAAATTAAAGCTCCTCATGACATTCATAGAAACAGCAGGACTACCCAGAGAGGAGC
AAGTTTCTTGATTGCCACCAGTAGAGTTGAAAGATAGCCTACAGCCTCCTTCCCCTCCTTCCTCCCTTCCGGCGGGTGCTGTCAGTGGGAACTGGAGTCA
CGTCCTCAATGCGCCCAATTTTCATCCCAGAACGAGCAAGAGCCCTGAGAGCAGACTGGGCTCCAGGTCCAGGTGTCTTGGTCTTGTTGCCTCCAGTGGC
ACGGAGCTTAATGTGCAGTGCGGTGATACCAAGCTCCTTGCAACGGGTAGCAACATCCTGAGATGCAAGCATAGCAGCATAGGGTGACGATTCATCACGA
TCAGCCTTGACCTTCATGCCACCAGTGATCCGCACCAGGGTTTCCCTCCCAGACAAGTCAGTCACATGGATGAAGGTGTCATTGAAGGATGCAAAGATGT
GAGCAACGCCAAAGACATGCTCTCCCTCACGGACAGCCGGTCCAAGGGTGACATTCTCCTCCTTGGGCTCCCTGGTCTTCCTCTTCGACGACATGGTCGC
GCGGAGCGGCGGTGGATCGGAGACGACGACGGCGGAGAGGGGGAGAAGTGCGCGCCTGGTTGAGATCACGAGTGCGCCCTCGTGC
page-top