Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2156  (registered. 2012)
Contig Information
Length 799 bp
Clones alternative view 160 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 2
Wh_r Root 4
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 12
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 3
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 7
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_SP 5
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 10
WH_XF Seedling, infected with leaf rust 10
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|126513558|gb|ABO15891.1|| translation initiation factor eIF1 [synthetic construct]
Score 232
Evalue 4.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2156
TTTTTTTTTTGAGAAGATAAGCCTGAAGTACATTTATTTAGTGCACAATAACCTGGATAAACCATACTGCCATACTGGTGGCGCATACAAACCATGTTGA
AGGACAACTTGCATCAACACACCGATGCAAATTCAAATGTCTTGGATGTAAAAGTGCATCAAACACAGATGCCTCACACGAGTACTAGCAATTCAAATGT
CTTAGATGTGACAATACCAAGTATACGACAACTTCCAGGCTTCGGTGACAGCACACGAGCATTTGTGTGTTGCCTAAAATCCGTGAATCTTGATGCTCTC
TTTCTTTGCAAGTCCAGCCTGAACTAGAAAAGTAGCAACATTTTTACGCTGATCACCTTGGAGTTGGATGACCTGGCCTAGTTCTGGATCCTGGACTACA
GTACCATTACAGCAGAATTCCTTTTTGAGATCCTTGAGAATCTTGTTGTAGCTGTAGTCTTTCTTCAGACCCTGAACAGTTGTCAGACTCTTTCTTCCGT
TGCGCTGCTGGACACGCACATGCACATAGTTCTTTGATCCAGCACCAGCGCCGGAGTCCTCAGCATTTGCCTCAGCAAACGGATCAAAAGCAGTTGGAAC
CTGGACGTCGAGATCAGACATGAACTTGTTGTTTGGTTTGATTGGCCCCAAACAGACAAGGCTCTATTTATTGTCTTGATGTGTGAGCTTGTCCGGTGGT
GCGAACCGCAGACGGCGAATGCGGGGAGGAGGAGAAAGGCAACACGGGACGAGACGACTTGACCTCGGGGGAAATATCTGTCTCCTCCTCTCTCTCTCC
page-top