Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21541  (registered. 2012)
Contig Information
Length 703 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253960506|dbj|BAH84976.1|| silicon transporter [Hordeum vulgare]
Score 278
Evalue 5.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21541
AGCACACCGTGCGTGATAATCATCTCCCTCTCCTTCTCTTCTCACCATACATACATACATATACTAATTAATCAACAACGCACACAGCAATTAACACACA
TACGAAAGCGGAGGCTATGACCTATACGTACGTACGTACAAAGTGCCCGTATATACGCTTGTGTATGCACATACGTATGTACAGGCTGCTGGTATATATA
AGGAAAGTGTATATTGCATATAGTTGGACCGTCGGCGGTGGCGAGGGCGATGTTGGTAGATGGATAGGGTGGCTACATCTTTCCGATGAGGGGGATGCCG
ACGGCGGTGACGATGAGGGTGGAGGGCACGCCGAAGATGAGGTGGTTCCAGAAGGTGAGCTCGTAGGCGTTGCGCGGCGCCCGGCGCGCCTGCTCGCACA
CGATCAGGTTCGCCGCCGACCCCAGCAGCGACAGGTTGCCCGCCACCGTGCTCACCCACGCCAACAGCAGCCACGACCGAGTCACCGCCGCCGGGGAGAT
CAGAGCCGCCGCGGTCGCCACCTCGTTCCCCATCAGTAGCACTGTTGGTACGTTGGAGGCGAGGTTGGAGAGGAGGAGGATGATGACGGAGAGCACGGAG
ATGCCGCCGGCGCTGTCCACCTTGGAGTAGGGCGCCATGAAGTTCCAGATGGCGCCCGGCAGCCCCGTCTTGTTGAACCCACTCACCGTGATGAACATGC
CGG
page-top