Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21498  (registered. 2012)
Contig Information
Length 1417 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_VSCB Liquid cultured tissue 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|18481622|gb|AAL73486.1|AF464903_1|AF464903_1 repressor protein [Triticum aestivum]
Score 508
Evalue 5.00E-142
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21498
ATGGTTCAACCAACAGTAGCACACTGAAATCAATTACTATCATCACGGGTGAACATTAAGTCAGGCAATTGATTACACTGGTAATGGAGTAGCTTCTGAC
ACGTCACACACAATACCATGAGACTACAACAGTCATAAACACAGTATCCAGCGCAGTAAGTACATCGCTTACTAGAGAGCTTCAGATTATTAGAGACACG
GTGGCTGAAATCACACACGATTTACATTGTACAAGATGCAGGCAAACCTAACGCACAATTTTAAAGGAGGCAGAGTCTTAACTTATAGTGACGCTACATG
TTCCGAACCACTAACTGTCCAGTTCAGGCCATGTTCCGCTTGCAGTTGTGTTAGCGGCTGGGGCTGCTGCAGTTCAGGTGGCTGGGGTTGAGGTTGCGGC
AGCGGCGGCAGCGGCACTTGCATCGGCTGGGGTTGCTGATGGAGCTGCAGTTGAGATTGCGGGGATTGCTGGGGCGGAGGTTGCAGCAGCAGTGGTGCCG
GTTGCAGATGGAGCGGCAGTTGAGATTACACAGGTTCCTGTGGTTGATCCTGAGGATTGAGGCTGCAGGGGTTGCTCAGGTTGAGCCTGAGGATACAGCT
GCAGTGGAGGTTGTAGGGGTTGCTGTGGTGGAGCCTGAGTATACGGTTGCAGTTGAGGATGCAGGGGCTGCTGTGGTGGAGCCTGAGTATACGGTTGCAG
TTGAGGATGCAGGGGCTGCTGTGATTGAGGATGATGCAGTTGCGGTTGAGGTTGTGGAGGCTGCTGTGCTTGAGGATGCAGCTGCAGATGAGGTTGTGGG
GGCTGTTGGGGTTGATTCTGTGGTTCTAATGCAGGCTCCTTTGGTTTGGCAGCTCCATTGTTCATCCTTGCTCGGGCTTCAGCAAACATTCTCTGCTGTT
CAGCAACAGCTTCTTCTTCTGTCATCTCTATGCCAGTGAACTTGGTTGCTTTTGGAGAGTCCAGGGTTTCAAGCTTGTGCTGTTCGTAGGCTGCATAAAC
TTCTTCAACATACTCCTTGAAGCCAAGATCCTGCAAAGCCCTAATAACATGTTCAGGGGCAATAGTTTTCTTGTCGTCCCGGCTGCACACGTCATTGGAT
TCCGAAGAAAGAAGATTGATGAACTCTACACAGCATTCAACAAGAAGATCCTGTGTATCTCTTGCTACTCGAACATCAGGCGGTAGCATCTCCTTAATAA
TCTTGGTCATTGTTGATTTGGGGAGGGAGACGTCCTCCTTGGACTTGCCCACGATGTCCATCGGATCCATCCCTCGCCGTCGAAAGCGCGACGGAGCTTG
AGCCTGGGGGCGCCGGCGCCGGCGCGTCCCGCCGGGAACGGGCGGCCCGCTGCTAGGGGAGGGAGGGCTTGGCCTTCGGCGATGCGCCCTGAGACACGAC
CTGGTTGCGGGAGGGGA
page-top