Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21494  (registered. 2012)
Contig Information
Length 794 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242085002|ref|XP_002442926.1|| hypothetical protein SORBIDRAFT_08g005000 [Sorghum bicolor]
Score 264
Evalue 7.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21494
TTTTTTTTTTAGCAAATCTGAAAGTTTTATCTTGTCTTCATGTGTATATACTGGATTTTTTTTCCTCTGGTACACCAGATTGTACAACAAAAATTAGGTC
CCCTTGACAAAAAAGGAGCTATTTTGCATAAGGCACCCTACGCTCTTAGTCTTCATTACAAAGAGCACCTCCTGCCGTTCTGCTTAGGCCCCTCATTTTC
CGAGGTATGCAACCAAAGGCCGCCTAATCCGGTAGGTGCAATAACTAGGTTCAACAGGGGCCTCTCGGCGAACGTGTAGTATGTATGTATAGCATGCGGT
TATAACTAAGTTGGTGCACGTGCGGCAAATCAGCCGCTGAACGGCTTGTACACTTTGAGAGCTTCGATGACGTTGGCGATGGAGCCCGCCGCGGCGGCGA
TGGAAACGATGAGGCATCCGACGCTGAGCATCCTAAGGCAGATCCCCTGCATGCTCCGGCCGGGCACGCCGCGCTGCCTGATGTACATCTCGACGGGGAA
GTAGACGGTGAGCGGCCAGAAGGAGACGGCGCCGAGGAGTCCCACCACGTTGCCGAAGAACGGGAGCAGCATGGCGAAGACGGTGGTGAGGCAGACGAAG
GCCGACCGCCACGTCAGCCGGAACACGCTGAGCGCGAATGGCCCCACCCGGAACTCGCGGGAGATGAAGACGCTGTCTGGCCATGTGGACGCGGCCCAGC
GCTCGACGAAGGCGAAGATGGGCTGGCAGAAGACCTGGTAGGCGCCGACGAGGTGCACGACGATGGCCACGTTGGCGATGTCCAGCAGCCAGAA
page-top