Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21376  (registered. 2012)
Contig Information
Length 932 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_SHC Shoot grown with cold treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 3
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115439261|ref|NP_001043910.1|| Os01g0686800 [Oryza sativa (japonica cultivar-group)]
Score 409
Evalue 2.00E-112
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21376
TTTTTTTTTTACAGCATCAGCGACTCATATTATTAGATCACACGAAATTGCAGGTCATTTGACATCATTCTTAGAAAATCCCTCGACATAACAAGCAGCA
ACGCTGGTTCCATGATTCACGAGACAATATATTGAACAGCCAAAACCAACAAACGATGCATTATCCATGAGATCATGACTGCGGCTAAGACACAGATAGT
AAATTAAGCAGAAGTACCAAGGCAGATATTACGCCTCAAGACAGTCAAAAAAAGAAGATACCACAGCCGTTTTACCAGAACAGAGGCCACTAAAACAAGA
TACATAATCTAGCTAGAGTAGCTGAACCCCGAGATCTTGTAGATGCGGATAGTTCCATCGGTGTAACCAGCATAGAGAGTGCTGCCATCCGCGCTCCAGC
TCAAGCAAGTGCAGTAGAGCATCTGCTTCGTGGAGACAGGGACCTCGGGCCTAAGGTCCTGCACGATGTGCTTTGACTCAAGATCCCAGATCTTGATGGA
ATCCTGTGTCGCCGCGCAGAGCCAGTAGCGGTTGGGCGAGAAGCAAAGTGAGTTGATAATGGATCCCGCATCCAGCGAGTAGAGTCTCTTGCCCTCGGTC
AAATCCCACAGCAAGGTGACGCCATCCTTGCCACCAGACGCGCAGAGCGAACCGTCTGGGCTGACTGCGACGGCGCTAACATAGCCACCATGACCATCAA
GAGTGCAGCGGAGCTTGCAGTTGGTGAGGTTCCAGACCTTGACGGAGCGGTCCCATGAGCCCGAGACGATGGTCGGGGCGAAGTTGTTGGGTGAGAAACG
GACGCAGGACACCCAGCCAGTGTGGCCCTCGCCGCCTCCGAGGTCACCGCCGATGGTGTACTTGCACTCACCGAGGGTGTTCCAGAGCTTGATGGTGCGG
TCGCGGGACGCCGAGACGATCTGTCGGTTGTC
page-top