Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21331  (registered. 2012)
Contig Information
Length 863 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 3
Wh_VSCB Liquid cultured tissue 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|285028876|gb|ADC34699.1|| elicitor responsive gene 3 [Triticum aestivum]
Score 295
Evalue 6.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21331
TTTTTTTTTTATTGCAACTCAGTTTAGTGACATTAAAGAGGCTCATACTTCATACAAGTGGGGAACACTGTTATTACAAATTTGAATATTAGAAAACGAT
ACCAATCAATAAGTAGATTCGTAGCTTATCCATAATTGAGGGAATCAACGACAAATACAGTCTTTAACAATTAAAATAGGCTTTAGTTCTAGCACACGAC
TTGTCACGCACCATAGTTCAGCAAAGCACCTGCTTCTTCTCAAGATGATTGGTTCCACCCACCATAGTTTTCCTCGGGTTGATCCTGATCACGAGCCTCC
TCCGGAGTGAACGTCAGACCAATTTTGATTTCTCCACGGTACTCTTCGTCTTTGACAACATTGTAAACAGTTGGTGGGATGCTTCCTTCAGTGTACACTC
CATCCAATGGGATCGTTGCTTCACCAACGCTGTCGTCGTCCGTGCCACCATCACTGTCCAGTAGCTTGATGACAAGCTCAGTTGCATTCTCAGAGACGGT
GAACACAAAGGTTTCGTTCCACTCAGGATCACTTCCCTTTCCAGAGGCGACGGTGCTCTTTTGCTCCTGCGAGGTGCATTTTAGAACCGCGTACGGGTCC
ATGTTGCAGAGGTAGTCGGTGTTCTCGAGGCCCTTGGCTCCCACGAGCAGCACCTCCAGCGTCCCCTGCGCCATCTTCTCTCCCGGCCTGATCTCGCCTT
CCTCTCCCGCTCGCTCGATCAGGAATTATATGCTGATGAGCAGGCGGCACGACTGAAGGTCGAGACTAATTGCTGTAGATCCGATCCGAGCCCCGGGGTT
CCGCTGTATGTATAGGACTAGGNNNTGAAAAATGGAAAGCTCGGCCGCGTCTTCCTCGCACAT
page-top