Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21307  (registered. 2012)
Contig Information
Length 814 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242062416|ref|XP_002452497.1|| hypothetical protein SORBIDRAFT_04g026930 [Sorghum bicolor]
Score 399
Evalue 2.00E-109
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21307
CATCTTCTCCGAATCTTTACAAAAAATATATGAAGGCACAATTATTGTTGTAATGCCGACAGATAGACGTTGGATCACAACTTTGTTATACACGACTATG
GAAGATTACTGGACATCAGGTCTTCAAAATATCGTCCCTCTTTGCGGCCTCAAATCTATCAGACAGTAGAAGTGAAAGACACGGCGTGTTTCGGTTCGGT
CTTCACGGTCAAGCTCAGCACCTCAGGGCGCGCGTAGTGTCCCACGACGTCGAAATCAAACTTGGCTCGAACAATTTCTCCAAGGTCCAGGTCAGCTGTG
AGGAGGGCCTCGCCTTCATAGTTGGGACCTGCCAACACTGTCCCAGATGGCGAGATGATGGCGCTCCCTCCAGGACAAACAGCGGTTTCTGGGGATGGCT
CCTCCTCATGGCCACCAAAGGTATACTCAGGCGAGGGAGGAAAGTCTTTTCTGCGGCAGAACTGGTTTGCTGTCAGAACAAAGCATCCCCCTTCAAGCGC
AATGTGTGTCATGGAAGCCTGCCAACTTGGCAGCGCATCCGCAGTGGGAGCACAGTATATTTGAACACCTTTGGCATACATCGCTGTCCTGATAAGTGGC
ATTCTGTTCTCCCAGCAGATGACGGCACCTATCTTTCCAAGTGGAGTATCATAAACAGGTATCGTAGATCCATCTCCAAACCCCCAGAATACTCGTTCCA
GTGAGGTAGGCATGAGCTTGCGGTGTTTTCCTAGGTACTTTCCCAGAGNNTCAAAGGAGAGCACTGTATTGTACAGTGTGTAGCCTGCCCTTTCAACAAC
CCCAATCACCAAAA
page-top