Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21287  (registered. 2012)
Contig Information
Length 803 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 2
WH_XE Seedling, infected with leaf rust 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115442509|ref|NP_001045534.1|| Os01g0971500 [Oryza sativa (japonica cultivar-group)]
Score 246
Evalue 2.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21287
TGCACAACAAAACTTGGTCCCATCAATTTCAGTTTCACGACAAAACCGTTGCAACATTCAAACAACTCACCACACGGTACATTGGAATGGATACATCACG
CGACAAACTACTAACTTATTCCAACACCTTAAAGCTATTTTTTCCCCATAACCCAGAGAACAATGCCGCCACCGGTTAAGCCGATTCCGACTTGGTGTAC
ATCCTAATGGCGACAGCCAGACCAAGTATGGCCAAGGGGACCAGGAACTGGAGGATCTTGATGATGAACTCAGGGGTCTTGTCTTGGTTGTAGTGTGGTT
GCTTCGGCGGAGTGTACTTTGTCCGGGCAGGTATCGTAGCCGTATCCACGTCGCCGACATAGTACTCGTCCAGCATCGCACGGGCGGTGGTGCTGTGCCC
GACATCCTCAAAGTCATCAGTTGCGTCCTTGGCAGTCGAGGACAACAGTACATCATCACCTGCAGGGTGATCCTCCAAAAACTTGGTCACATCATATACC
TTGCCGGCGATGATGAGCCAGCAGTCGTCCTTGGTGTTGTGCTTGGACACCTCCTCCAGTGTCAGCGCCGCCTTGGACATCTTCCCCCTGCTTCTCCTCC
GCCTGGTCGAGTTGATACGAGACTGGGATTCGCAGCCGCAGATCCGCAAGAATTCAAGCTGCTGCTGCTACCTGAGAAGAATCCGGCAGGGAAAGGTGGG
TGGCGATGCGATACGATGTGAATCTGGCTGGGGATACGATTGCGCTTCTCTCCTTTTTATAAAAAATCGCGAGGAGACGGGAGGAAGCGCTCGGCAACAA
CCA
page-top