Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21088  (registered. 2012)
Contig Information
Length 836 bp
Clones alternative view 128 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 8
Wh_EM Dormant seed with water absorption 9
Wh_EMI Dormant seed with water absorption after breaking 12
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XB Root 14
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22204120|gb|AAM92708.1|| putative ribosomal protein S18 [Triticum aestivum]
Score 307
Evalue 1.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21088
TTTTTTTTTTGCATAAGAATAGACGAGCTCTTGCCAACCATTGAAATGACTAAAGCCCATGGCAAAACAAACTCTCAAAGAGTTCAAGAAGGAATTCAAG
ATACAATATATTAAAGGTTCCAGAACAAAGACATTATCTAGGGCAAAACATCATCCAAGGTAATCGTCTAAACAAGAACACTCCTTAAGATTCTGGAAAT
GGACCAACACAGTAGTAGAAAAGCTATGGGGGATCGTTGTGAAGCAGCTTATCGCTTCTTGGAGACACCAACAGTCTTTCCTCTCCTGCCGGTAGTCTTG
GTGTGCTGACCACGGACACGCACGCCCCAGTAGTGACGCAGACCACGATGGTTCCTGATCTTCTTGAGCCTCTCAAGGTCATCCCTGAGCTTCATGTCCA
CGGCGTTGGACACGACCTGGGAGAACCTGCCGTCCTTGTAGTCCTTCTTCCTGTTGAGGAACCAGTCCGGCACCTTGAACTGGCGCGGGTTGTGCACCAC
CGCCATCAGGCGGTCCATCTCCTCCGAGGAAAGCTCTCCGGCCCTCTTGTTCATGTCGATGTCGGCCTTCTTGCAGACGATGTTGGAGAAGCGGCGGCCC
ACACCCTTGATGGAGGTCAGCGCGAACATGATCTTCTGCTTACCGTCGACGTTGGTGTTGAGCACACGCAGGATGTGCTGGAACTCCTCACCCGCGATCA
GCGACATGGCTGCAGTCGGCGGCGGCGGCGGCGGCGGCGCTCGGGGGCAGGAGGGGAGGAGGAGGGCGTTCGCAGACATTCATGTACTGGAACGTGCTGA
AGATGATGTACCGCGCGCCCGTGACATCCAGCTACC
page-top