Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig21076  (registered. 2012)
Contig Information
Length 970 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|40643247|emb|CAC83766.1|| allene oxide cyclase [Hordeum vulgare subsp. vulgare]
Score 458
Evalue 4.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig21076
GTCGCCACCACCACCACCAGCACCAGCACCATGGCAGCGCCCCCCTCCTCCGTCTCCGTCAGGGCCGGCGCGTCCGTCTCGGCGAAGCTGACCCCTTCGC
GGGCCGCCAGGGTTGGGTTCGGTGGCAGGGTCAGCGTCGGCTCGGGCAGGAAGTGCGGCGGCCCCGTGCGGGCGTCGCTCTTCTCGCCCAAGCCCGCGGT
GGCCATGGACGCGAGGCCGACCAAGGTGCAGGAGCTGCACGTCTACGAGCTCAACGAGCACGACCGCGAGAGCCCCGCCTACCTCCGGCTGAGCGCCAAG
CAGAGCCAGAACGCGCTCGGCGACCTCGTCCCCTTCACCAACAAGGTGTACAACGGGAGCCTGGACAAGCGGATCGGGATCACGGCGGGGATCTGCATCC
TGATCCAGCACGTGCCGGAGCGCAACGGCGACCGCTACGAGGCCATCTACAGCATCTACTTCGGCGACTACGGCCACATCACCGTGCAGGGGCCCTACCT
CACCTACGAGGAGTCCTACCTCGCCGTCACCGGCGGCTCCGGCGTCTTCGAGGGCGTGTACGGCCAGGTCAAGCTCAACCAGATCGTCTTCCCCTTCAAG
ATCTTCTACACCTTCTACCTCAAGGGCATCCCGGACCTGCCGAGGGAGCTGCTCTGCACGCCCGTCCCGCCCTCCCCCACCGTCGAGCCCACGCCCGCCG
CCAAGGCCACCGAGCCACACGCATGCCTCAACAACTTCACCGACTAGCTACCCACCTACTCCTACCTAGGTAGCCAGCCCAAAATATCTAGTATTGCTCC
TGCTAGTTGAACTTGCGTGTGTGTGTGTGTTGCAACTTCATCGACTAGCTAGCTCTAGCTAGGTACCCCAAAATATAGCCATGTACGCCAAATTGCTTGT
ACTCCTACTGGCGTTGAATGAATGTCCGTGTGTTGCAACGGTGGAATAATTTTAAGTACTAAAAAAAAAA
page-top