Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2104  (registered. 2012)
Contig Information
Length 616 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VABA Shoot with ABA treatment 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242065592|ref|XP_002454085.1|| hypothetical protein SORBIDRAFT_04g024330 [Sorghum bicolor]
Score 224
Evalue 4.00E-57
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2104
TTTTTTTTTTAAAGCTAGCACACTTCAGAACATCAGTCAAACACCAACAACATAACATAATTCCACATCAAGAACAGCTGGTACAGCCAATATCAACGTC
TTCTTGGCTCTAATAAGAATATTGCTCCGTACAAGTAAGAAACCAGATTACACTGCACACAAGCATGCAGTGCAAAATTTCCAAGGTATAACATAGCTCA
GCGCCCCCTGCCACGACCGCGCCCACGACCACGGCCGCGCCCACGACCCATAGGTTTCCCTGCAGTAGGCTTCTTAGGCTTCACCCTTGGTGTTTCCTCA
ACCAGCAACGTCTCCAGGTTTAAGCTGTCAGGAAGGATGTAATATCGAATGTTGTTTCCCCTCACACTAAGGTGGTCAAGGGTAACAGGATTCTTCCCTT
TCAATGTGAGCTTGACAGTCTTCAGATGAGTATTCATGCTGATGTCGACGCCAATGATGGTGCCGTGGACGGTGGTACCATTCTTGAGCTCGATGGTCAC
CGTCTCGTTGTTCAGCTTCATCAAGAATCTGACGAGCTTCATTGTGGAGGCGCTTGGTGGCGGAGGTAAAGCTAGGGTTTTTGCCCTCGTGCCGAATTCG
GCACGAGGCCTCGTGC
page-top