Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20985  (registered. 2012)
Contig Information
Length 1190 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_KMP Shoot grown under continuous light 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VABA Shoot with ABA treatment 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242052385|ref|XP_002455338.1|| hypothetical protein SORBIDRAFT_03g008760 [Sorghum bicolor]
Score 493
Evalue 2.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20985
ACACCTGTCAAGGTACGAGGAAGATCATGGCGTCCGATGTCAAGAGCAGGATCCTTGTGATCGGCGCGACGGGGTACATCGGCAGGCACGTCGTCGCGGC
GAGCGCGCGGCTCGGCCACCCCACCCTGGCGCTCGTCCGGGACGCCGTCCCCTCCGACCCGGCCAAGGCGCAGCTGCTCAAGACCTTCCAGGACTCGGGC
GTGACGCTCCTCACGGGCGATCTCTACGACCACGGCAGCCTGGTGAGCGCCGTCAAGGCGGCCGACGTCGTCATCTCCACGCTGGGCGCGATGCAGATCG
CCGACCAGACCAAGCTCATCGCCGCCATCAAGGAGGCCGGCAACGTGAAGAGGTTCTTCCCGTCGGAGTTCGGGCTGGATGTGGACCGCACCGGCGCCGT
GGAGCCGGCCAAGTCCATCTTCGCCCTCAAGGCGGGCATCCGTCGCGCCATCGAGGCCGAGGGCATCCCCTACACCTACGTGGTGGCCAACTACTTCGCC
GGGTACTCGCTCCCCACCATCGGGCAGGTGCTCTCCCCGGCGCCCCCGACCGACAGCGTCGTCATCCTCGGCGACGGCGAGACCAAGGTCGTCTTCGTGG
ACGAGGCGGACATCGGCGCGTACACGGTCCTGGCGGCGGACGACCCCCGGGCGGAGAACAAGGTGCTGTACATCAAGCCGCCGGCCAACACGCTGTCGCA
CAACGAGCTGGTGTCGCTGTGGGAGAAGAAGACCGGCAAGACGTTCCAGAGGGTGTACGTCCCCGAGGACGCCGTCCTCAAGCAGATCCAAGAGGCGCCG
ATCCCGATGAACATCATCTTCTCGATCGGGCACGCGTCGTACATCAAGGGGGACCAGACCAACATCGAGATCGCGCCGTCGTTCGGCGTGGAGGCGAGCG
AGCTGTACCCTGACGTCAAGTACACCACCGTCGACGACTTACTCAACAGGTTCCTCTGAGGATATGCTGCTGGTCTATCTGTGCCTGAGTCCAGTGATAG
TTTTTTTTTCTTTCGAAACGAGAGTCCAGTGATAGTTAATGTATCATGTATGAACGGACCGTGTATGTTTGGGACTGATGATGTCTGATGAGTCGACAGT
TGTATGCTGCTGGTTGCTTTTGTTGGTTTGTAAATTGTATGTCCTCCTCCTTCATGGATGAATAAATTACTCGGGATAAAAAAAAAAAAA
page-top