Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20963  (registered. 2012)
Contig Information
Length 742 bp
Clones alternative view 80 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XT Roots, 18 day old plants were grown hydroponically 14
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 11
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 9
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|56090131|gb|AAK55323.2|AF355455_1|AF355455_1 thaumatin-like protein TLP4 [Hordeum vulgare]
Score 312
Evalue 2.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20963
TTTTTTTTTTAGATTTTTTTTTTGAGATATTCCTTACCTGTATTTATTGACTTTATCGGGCACTCGTACATATTCGCACGGCCATTATTACATGGAAAAT
GGAAGTACAAATAGTTTAGCTTTCGCGCGGACATAGTATTACACTTCAGATAGTATTATGGTCGTCCGTGGCATGGCACGCATGCATATGATAGAGTAGC
TCATCATGGGCAGAAGACGACATTGAACCTCCTGTTGCCGCTGCAAGCTTTGGTCCTGACGTCGTTGGGCTGGTGGTAGGCGTCGGGGCAGCTGGGGTCG
CGGCACTGGATGTTGACGCCGGTGCTGCAGGAGAAGTCCATGGGGAGGTTGTACCCGTCGATCACCGAGATGTCGTAGAAGTCCTGCGAGCCGAGGGTGA
ACTCCGCCAGCGTCAACGGGGACTGGCCGGACAGGGTGCAGGACAGCGCGCCGCCGCAGTCGCCGGTGCTGCATCTCCCGCTGTTGCCGTTGAAGCTGCA
GCCCGTGCGGCCCCAGATCCTGCCGGAGCTGGTGCCGCCGGGGATATCGAGGTTCCACGTTTCGCCTCTGTTGAGCTGCCGGCCACCGCCCACGGGGGTG
GCCGCCGGCCACACCGTGAAGGAGCAGCGGTTGGTGATGGAGAAGCTGGTGGCGCTGGCACCGGCGACGAGCCCCACGGCCAGGAGGAGGATGAGCGCCG
ACGACGAGGCGGCCATTGTTGCTTGCTTGCTTGATTGCTGTG
page-top