Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20949  (registered. 2012)
Contig Information
Length 1181 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 6
WH_XR Roots, 18 day old plants were grown hydroponically 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|290972549|ref|XP_002669014.1|| predicted protein [Naegleria gruberi]
Score 232
Evalue 8.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20949
CGATGAGGACGCGCCCCTCCTCGTCCTCTCTTCTCGTAGCACCGCTGCTGCTTATGCTTCTTCCAGCGTTTGCTCTTGCTGCAGGGAGGCACACCTTGAT
CACTAGAGACCCTCAATACGGCCCCCGGGCTAACCCAAATCCAGAACCACTTCCAGGAAAACAACCAAATCCAAATCCTCAACCATTGCCAGACCCACAA
CCACTGCCAGGACCACGACCAGACCCAAACCCGCAACCACTACCCGATCCTAAACCTAATCCAAACCCACAACCACTGCCTGAGCCACAACCTGATCCAA
ATGCTCAACCATTACCAGGACCACACCCTGACCCAAACCCACAACCATTGCCAGGCCAAAACCTGCAACGGTTGATGAACCCACGGCCAAACCCAAACCC
GCAGCTACTACCAAACCCACGGCCAAACCCAAACCCTCGTCCATTACCAGGACCGCAGCCTGATCCAAATCCACAACCATTACCAGACCCAAACACAAAA
CCATTGCCGGACCCACAACCAAACCCAAACCCTCAGCCATTACCAGGACCGCAGCCTGATCCAAACCCACAACCATTTCCAGACCCAACCCGAAACCATT
GCCGAACCCACAGCCAAACCCAAACCCTCAACCATTACCAGGACCTCAGCCTAATCCAAACCCACAACCATTACCAGACCCAAACCCAAAACCATTGCCG
GACCCACAACCAAACCCAAACCCTCAGCCATTACCAGGACCGCAGCCTGATCCAAACCCACAACCATTACCAGACCCAAACCCACAACCACTGCCAGGCC
CACTGCCGGACGCGAATGCACAACCAAAACCACCACTTGGGACACAAGCGGAAAAGGAAAATGTGGAAGCACACATCCAAGAGGAGCCACTGGGATGAGA
TGTTCGAGTACATCAACCGTGCCAGATATAGTATACTCATGACTTATATTGCCTGCTGGATTAAATAAGTGGTGTGTTGTAACCCACCACCATCAAGTCA
TTCTGTGCTATATAATGTCAAGATCAATCAAGATTAGGGTATGATGCCCATGTAAATCTTGTGATTGTTCTGACTTACTTTTCTGGCTTGTATGGATGAT
AATTGTATGTGTGTGCTGGTTGTACTATGATTGTGTGATGATATATATTAAAATTTCTACTTTGTACCCTTAAAAAAAAAA
page-top