Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20940  (registered. 2012)
Contig Information
Length 851 bp
Clones alternative view 42 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_oh Pistil at heading date 1
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 5
Wh_SHC Shoot grown with cold treatment 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471700|gb|AAW50981.1|| ribosomal protein L6 [Triticum aestivum]
Score 436
Evalue 2.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20940
GTCACAACAAGCCAACAAAGGGGATGGTACTTCCTAGTTATCTTCTCAAAATATTTGACAGGCAGACTTCAGTGGAAATCAAATATTCACCAACCAGGCA
AAAGAAATCAGAAGTACAGAACCAGAACACACACTAGACAAAAAAGACTTCCACAGATCTTGAAACTTGTACCAGGTAACTTAGAAGGTCATCTCATGCG
GCTTGTCGCCATCCCTGAGGGAGAACCGGGCACCAAGATAATTTTTAAGGTCTGGGACAGCATCGATAGCCTTGATCAACTCAGCGTCAATGACCTTCTG
GTCATCCTTCTTGAAGTCTGGCAAATTCTTGGTTGCCTCCTTATCCGACTCAAATAGCTCGCCCTCAGTCTTCTTTGCCCTAGTCTTCTTCTCCCTAGCG
AAGTACTTGTCATCAAACTTCTGCACATTAACCTTAGAGATGTCGACCTTTGTGGATGTGGCAATGACGTAAGCCTGGTTCACTCTGCGGATTGGCACGC
CATTGATCTTGAAAGGTCCAGTGATGAGGAGAAGGCCGGACTGGAGCTGCTTGAGGAACACCACGCGCTTTCCCATGTACCTCCCCGCGAGCAGGATCAG
CACCGTGCCCGGTGTGATGGTCGATCTGAGCTTGGTGGGATGGGGCTTGCGTGTGCTCACGGTGCGTGGCTTGACATCATCAGCGGGATAGAACTTGGGC
TCGGCGACGGCGGCCGGCTTCTCGGCCTTGGGCAAGGCGCCGCCGTGCTTGGCCTTGATGGCCCAAAGCCCGCGGCGGTGGTAGGTGTGCGATCTCGACG
CCCGCTTTATGCCGAGCGCCATCTTCGACGTCGGAGCCATTGGTGATTCTT
page-top