Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20915  (registered. 2012)
Contig Information
Length 923 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|186886546|emb|CAM96550.1|| 23.1 kDa heat-shock protein [Aegilops longissima]
Score 377
Evalue 1.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20915
TTTTTTTTTTGAGGAAATCAACAGAATTTCATGACCAATTTCACCACCAAAGCAAGTTCATCATATGCCGAAACTAGAGCAAATTTGACAGAGTTCGCGA
CCAACTTCACCATCAGACCACTACCTACTGGATCCAAGACGATCAACGAAGCAAAACAAGGAGAAAGACACCAAACATGCCCACATCAACAAGGCGTCTC
TCACACTCTCGCGTCGGCCATCCTCCATGAGCACTACCACGACGGCACTGCCTACTCGACCTTGACGTGGAAGACGTCCGTGCGCTCCTCCTCCTTGACC
TTGAGCAGGGTGACCCAGAGCACGCCATTCTTCATCTCGGCCTTGATCTTGTCCATCTTGTACGCGTCAGCAGCGGGCATCTCGATGCGGCGGTTGTACT
TTGGCACCGCGGAGTCGTCGTCGCCGTCCCAGGGCTGCTTCTCGCCCTCGCCCTCGATCACCAGGATGTTCTTGTCCGCGCGCACCTTCACGTGCTCCTT
GGTCAGCCCCGGCATCGGCACCTTGAGGTACACCGCGTCGTCGTCCTCCTTGGCCACCCACCGTCCGAGCCGCGACGCCCCAGCACCAGCAGTGGAGGAG
AGGCCGCCGGTCTTAGTTGCGACGTCCTCCATCAGAGACAGCAGACGGGCCATGCTGGTCGGCGCGCCGAGCGGGTCGAGCACGTCCTGCGAGAAGAAGC
TGGGGATGACGAGGTCGCGGTCGTCGTCGTTGTCGTCGTCGTAGCGGCTGACCTCCTTGACCTGGGTGTTGTACGGGCAGCGGGCGGCGGTGACGGCGGG
GGAGCGGAGCGGGCAGAAGGCCACGGGAGCAGCGGACTTGAGGAGGCTGGCCGGCGCGGCACCCTCGCCCTTGCAAACGACGGCGGAGGCCATGGTCTCT
CTCTCCTCTTCTCTCTCCTCTTC
page-top