Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20914  (registered. 2012)
Contig Information
Length 893 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|283837095|emb|CBH19892.1|| cell cycle switch 52B [Solanum lycopersicum var. cerasiforme]
Score 341
Evalue 8.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20914
TTTCAGGAAAAAAAAGCCAGGGGATTGTTACTTGTATCAACGTATCTGAGCGGATTGAAAATTTAGTTGAAGACTACTTTGTCCACGTGCGACTTTTGAC
TTCGGAAACACAGACCAAAACCTCAACGTCTCATCACCAGCACCGGTGACGATTGTTTGGCCGTCAGGGGAGACGGCGAGGTATAGGACTCTCATCAGAT
GACCTGTTAATGTTGCAACTTGATTCATTGATGGATATTGCCATATTGCGATTTGATTTTGAGAATATCCATGAGTTGATACCAACTCATTTACATTCTT
ACTCCACACAAGATTACAAACCTGAGACCCCGTATTAATATGCTGAAGCTCTTGAAACGAAACCGTGTTCCAAAAGCGAATGCATTGATCTGCAGTTCCT
CCTCCTGATGCTAGGAGGCCCCTTTGATGAGGTGACCAAGTTATTGCTTTTACTGCGGCTTTATGAGATGTGAATTGATGTAGGGGTTGTGTTATTTCAT
TCAGTGATTCTTTTGCCATTCTTTGTTCCCAAGGAATTAAATTATTATCATTTCCACCAGACGCCAGAACATTAGAAGGATCAGATCCCCAACGCAGTCC
ACAAATCTCTTGTTTGTGGGATATCATTTTTGATACTAGGCTTGAACTTGATCTTACGTCATAATTTAAGATTGTTTTATCACGTGACCCTGAAGATAAT
AACCAACGTGGAGAGTCAGACCAAGCTAAGGTTCCAACACGTAATTTATGATTTGCAAAAGAACGAACTTTTGACTGCTTCGTTATGTCCCACAACGAAA
CATCTCCGTCACTTGCTCCGACGGCGAGGTGCCCTCCGGAGCCCATCCAGGCAACAGATGTAACTTGGACATCACCAGGTAAGTCACAAAGCT
page-top