Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20908  (registered. 2012)
Contig Information
Length 1091 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57834129|emb|CAE05521.2|| OSJNBa0038P21.14 [Oryza sativa (japonica cultivar-group)]
Score 217
Evalue 3.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20908
ATACTACTCTGCCATGCCACTGCATCTGCACCCAAAAGCCTGAAACCTGCTGGTTTCTCGTTTGTCATGTGGTAATGATTGTTATAGTTTCTGAGCTGCT
GTGCAGGGAGAAGAGAAAAGAGGGGCGGCTGGCGTATGTACAGAAGGCAGGGGCAGGCACATTTATGGTTCAACCTTCATGTGATTTACTGTAGTCGCCG
GCTGGCCACTGCCTGCATTCAATGACATGAACGGGCCAAACAGGGCAACCTCAGCACAGAATCGAGAACCGGCCGTTTTCAGGACATGAAGAAACCAAGG
AAAGGTGATCTGGTATTTCACTCGCCGTAGAAAGCTTGGGGGTCCTGCCTATGGCTGCTGCTGGCTCCCCCCATCTGCACCATGCTCTGGAGGTCTTGCT
CCCAGCTGAAAGTGCCTTCTAGCTCTGCCCCGTGGCTGTGGCCGGCCGCGACGGCGACGGGTGAACCGGCGTAGGAGAAGCCGGGCACTGCCATCTCTTT
GGACGGGATCTGCTGCTCGTCGAGCTCCAACTGAGGATTCATGGTCGACAACTTCATGGACAGAAACTCGACCTGACGCTGCAGCGACTGGACGTAGTTG
ATGATCTCGTCGAGCATAAGTGCCTTGCCGGTGATCTTGTTGCAGCTTGGCACCAGGGACTGCAGCAGCTTCATCCTCTCACCGATCTTCTCCCTCCTCA
CCCTCTCGGCGAGGCTGTGACTATCGGTTGCCTGCCCCCTCCTCGCCCTCACATGGATGTAGTCCTTGGCCGGCTCCGCCTTCTCCTCCTCCACCGCGCC
TGGGTTTTCGTCGTTGCTGCCGTCGGCGACCCTCGGCCGCTTCGGCGGGCTCGTATTGATTGCCGCCATGGAGCAACTGGGCTGTACTGCGGGTAAAGAA
GCCTTCGCCTTGCCCTTCGCCGGGGCCGCCTTGCGCTTCCGCGCGGAACCGGCGGCGCCCTTTTTCGTGGGCGGGTCCTGCACTGCGGTTGCGGGCTGGC
TGTCCGTCTCGGGGCTCATCTCCAGTTGGGCGCTCTGATCCAATGGTGCCGTCGCGGCAACGCCGGAGGTGTTGCCGACGAGCGACTTGCT
page-top