Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20906  (registered. 2012)
Contig Information
Length 854 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222619059|gb|EEE55191.1|| hypothetical protein OsJ_03035 [Oryza sativa Japonica Group]
Score 337
Evalue 8.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20906
GTTCTAACTAATTATTGCTAGTTTATCTGTAATGTATAGGCACGAGTTTCCAGAGCCGCAAAGCTCAATGATCTAACACTACCAAATGATACAGCAACTG
TAAAAAAAGAAAGGAACGCACAACACAGCAGCATCTGCAGGTCAGCACTCAGCAGTGAAGCAAATGAGTCCACAGTCTGCTCTTCTCCGGGCAGGCCCTT
GCCAACACCTCCTTCAGGCTTCCCACCGACTTCAACCTCTCTTCCACCTTCCCTTTCACTGCCGCGTCTTGCTCTGATATCCAAAGAATGTAGAGCGCTG
CAAGCTCCACCTGAACGCGTGTTTCGCCAAACTCATCGCCAGGAGCACCCAGGCAGTCTGACAGGAGGTGTATCTCTTGGGATAGGAAGAGGTCTGCCAG
GGACTCATTTGACAGGCTGGTTTCCTCGCAGCTGAGCAAGTGTTGTACCCACCACTGTGAGAGGAACCGGCGATGGTTCCACAACGACTCTCTCCCTTGG
TATCGTCTGATGAGCGTCTCATTCCACCTCAGTTCCTCCTTCCACATTAGATAAGCTTCTGACTGGCAAATAAGGGAATCTTCTCTGTTCGCTGCACCAT
CTAGTAATGCAAGCAGCAGGGACCTGCGGTAGTGAAAGCTGCAGTTGTCAGCAACATGCAACTCAGCCCATTTTTTTGACTTGTTCAACTCATCTAGCAC
CTGTTTTGTTTTCATGTAAGGAATAAGCCAGCATCGATGCCTCCACGCGCGGTAGTTCATCTTTGATTTCTCTGCCATGTCTTTTACGAGTAGAGATTCC
TTGTCTATAAGCTCCGGCATGTCCTGAAGGTGTTGTGCAAGATTTTTTATCACC
page-top