Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20905  (registered. 2012)
Contig Information
Length 728 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|281202321|gb|EFA76526.1|| epsin [Polysphondylium pallidum PN500]
Score 145
Evalue 3.00E-33
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20905
CAACCAAGGACTCCATCTTGTCTTTTCTAGACACAGCAGTAACCGAAATAACCAAACATTCTGAGGTTCTTTCGGATAAAGTCTTCAACGCACCCGAAGC
TGAACAGCTCGTGAGAAAAGCTACAAACTCAGATGCCTGGGGTCCTTCTGGAACTGAAATGTTGAGAATTTCACATCTCAGTCTTCGACACACTGAATGC
CGACAAATTATGGACGCTCTCTGGGCCAGATTAACCTATAAAAATGAGGGAAAAAATTGGAGAAACGTCTACAAGGCTCTTTTGTTGTTAGAATATCTTC
TCAAAAATGGATCAGACAGAATTATCGGCGAAGTTCGAGGACAAATTTTTGATCTTAAACAACTCACCAAATTCGTTTATGTTGACGAAGGTGATGTTGA
TCGTGGTTTATCTGTCCGAGAACGCTCAAAACAAATTATCGAACTTATTCACGATTCTGAACGTCTGAATCAAGAAAGAAAAACGGCAGCAAAGAACAGA
GCAAAATACTCCGAATCAATTAGTTCCAATGGATCTGGAGGATCATCAGCTGGACATTATGCTTCACAATCTCATTTTAGAAAAAATGATCCAACCTGGA
ATTCAGGGGGCGATGATTTGGACAACCCAGGACTTTATCGTGGGGGACAAAACCAGAAAGCAGCATTCGGAGGATTTGATTCAGACTCCGATGATTTTAC
TGTCCCAAAAACTGTTCCAAAAAAAAAA
page-top