Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20902  (registered. 2012)
Contig Information
Length 1135 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|20161546|dbj|BAB90468.1|| hypothetical protein [Oryza sativa Japonica Group]
Score 468
Evalue 8.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20902
AAAACACAAGGAACAAGAAAAACAGTTCAAAGCACGCACGACACTCCCAGCAAACTGCAAACGCGGGATCAAACTCTAAGAAGGTAGACGCTAAGCTCGG
GGCCGACGCTGTTGGCATTGCTGCCGCTGTCCGGGTTGATCATGTAGAATGCCTCCGAGTCGCGCGAGCCCACCACGCGCTCGAACCGCGCGCGCATGTA
CATGACGTCGCCCTCGCCGCCACCGCATGACGCCGGTATGACCCCGGCCCCCATGGACACGGGCTCCAGCGCGCGCAGCACCCGCCAGTCTGCGGCCCCG
CACTCGCGCCGCACCGCGTACCCGCATCCCTTGCCGTTGCAGTAGGCGCGCCACACCGTCTCCTCCAGCAGCTTCCTGCCCGCGCCGGCGCCCGCGCCGG
CGCCCGCGCCAGCAGTGGTGCCGGGGAATGCGGAGGCGCCCTTGGAGCGCTCGCACTCGAGTGCGATGCGCACGAGGCCCGAGGCCATCTCGCGAACTAG
CGACGCCGTGGGCGCGGTCAGCTCCAGCAGCAGCGCCGGGCACGCGCGCGGGTCGACCTGGAACGCGAGGTGGACGTGGCCGCGACGGTGCCCGTACAGC
GTGCCGGTAAGCCGCGAGCCGAGGCCGACCTGCCGGTGCCGGCCGGAGATTGCCGCTGCCAGCGCCGTGCGCAGGCGCGACACGGCCGTGCGGCCCGGCC
TAGTATTCTTGCGGTGCTGCTTGAGCGGCTTGGGCGGGGGAGACACGAAGTCCTCCGAGTGGAAGGACCGGCAGGCGGAGGAGAAAGCCAAGGACGCCTC
CTCGTCGTCCTCGGCATGCTTATCCGAGCTGATCTTGACGAAACCTTCCTCCGCGGCGGCGGTGCTAGTGGCGCCATGGCTGCTGCTCTTGCCGAGAACC
GGCCACTTGAAGTGCCTCCGGGAGAAGGAGAAGGAGGACTCGTGGGGGCTTCTCTCCATGATGTTTCTCATGGTATGGTTTCTTGCAGAAGCTGCTGTCT
ATTGCGCGCCGGCTGTGTGTGCCTATGTATGGAGGATGATGGACGGAAGGAATGGGGTTTTGTACTGTGAGGGGAAACTGGTGAGCAGAACCCACCAAAC
TGAGCAGACAGGAGAGAAGAGAAGAGAAGAGAAGC
page-top