Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20900  (registered. 2012)
Contig Information
Length 1152 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197286|gb|EEC79713.1|| hypothetical protein OsI_21023 [Oryza sativa Indica Group]
Score 564
Evalue 6.00E-159
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20900
AATGTGACTGGTACTACTGATTCCACTTGGTTCGAAGAGCCAAGATTGCTGACTGTGCAAACCAATTCTTGCCTGACACACGGCTTTTACCCTAACTTGA
AGAGCTACACACCATATGCGACGACCGGGGGGCACCGCGGATCAAGACCACTCACCGGAACGACCACTGTATCTCCTCCAGGGTCCTCCCCTTGGTCTCC
GGCACCCAAAGTATAACGAACACGAGGGCGAACGCGCTCACGACCATGTACGACGCGAAAGTCCCGCCAGCGCTCCAGCTCAGCAGCAGGTTCGCCGTCA
TTGTCACCCCGAAGGAAGTGAGCATGTTGGCCAGCGTCGCGAAGCTCCCTGCGAAGCTCTTGATGCCCACCGGAAGGATCTCGGACATTATGAGCCATGG
AATGGCACCCATGCCGAAGGAGAAGGTGATGATATAAGCCACAAGAGCCACCAAGGACACCATGCTTAAGATGTAGTCCGAGTGAGAGTCATGTGGTAGA
TTGTCCTTGAGGAAAAATGCAACAGAAACTGCAAGAAGGCTTAGAGTCGTCCCGGCAGTGGAGATAATAAGGAGCATCCGTCGGCCAGCTTTATCTAGTA
GCGATGTTGTAACTCCAGTAGCGAGAACCTGAATAGCTCCAAGTGCACATGTGGCCAGGTCACTGTTTGTGAACCCTGCAGCTCTGAATATTCTACTTGC
ATAGAACAATATGCCATTTATCCCACATAGATTTTGAAGCACTAGAAGGCCAGTTCCTATTAGTAAGGGAGTTCGATACTTCTTTTGATTCAGCTCCTGA
AAACGGACCGTAGCCTTTTTGTTTGCAGATGCTACAGCTCTCTTTATATCGTTCACTTCGGCTGTGATGTCGGTCTCGAAACCCCTCAAAACTTGCAGAG
AAGTCTCGAAATCATCCATCAAGTTCATCTTTGCCAGCCATCTTGGAGACTCCGGGATGAAGAATAGACCAGGAATCAACAGTGTACAAGGCAAGGTTCC
TAGTACTGCAAGCAGCCTCCAAGGAACAAACATGCCTAGCACATAGGCCAAGAAGATACCAAGGGTGATAGATAACTGGTTCACGGAGCCAAGCGCTCCT
CTTGTGCTCTGAGGGGATATCTCTGCTATGTATACAGGCACCGTGTAGGATA
page-top