Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20899  (registered. 2012)
Contig Information
Length 718 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226528766|ref|NP_001148175.1|| DNA-directed RNA polymerase II 8.2 kDa polypeptide [Zea mays]
Score 149
Evalue 4.00E-34
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20899
TTTTTTTTTTAATAAGTTTTAAACTGGATAATGCATAGACTTGTTGGTTAATATAGCCCTGAAGATTACATACTAGAAACGGATGGTCACACTAACAGTC
CTTGGAGATTCATGAACAAACCAACTTCATTTCAGGACCTCACACTTTGCACCTCCTAAGCACTGACATAAGAAACAGCATATCATCCATCTTGAAAAGA
CAAAGGAACAAGGGTTTCGAGGCAGAATGGGTTCAATTTGTCTCCGTCTTCTCCAGGGTGTTGTAGTTGAGCAACTTCTCGATGAGATCAACATGGGTCA
TGAGCATACGGCGGCAGCAGTAGCGAACCAAGCCCAAGGCATCCAGAGCATCCCCCTCAGTGTAATCGGCCTGGAGAAGATCGAGGTAGTGGTCCCACTT
GTTCCCGATCACCTTGCCGCAGGTGAAGCAGCGGACCGGGATGATCATCTTGGATCCTCCGCCTCCGCGTTTGCCGCCGCCGCTTGACCTTCTGGAGTGG
CGACGGCGGGGGAGAATAGCAGCGTCGCCGGCGGCAGGGGTCGGCTGCTGGCAGGTTGGGGCGGCGGGGGAGAAGGACGGACTCGCGGTGCCGGGGAAGG
GCGGCTCGAGGACCAGACGGTTGTCGGGGTCGCCGGACGAAGCTCACCGGCGACGAGAGATGGCGGCGTCGGGACGGCCTCGTCGCTGGCGGCTAGGGTT
GACGAACGACCCTCGTGC
page-top