Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20834  (registered. 2012)
Contig Information
Length 1178 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 3
Wh_OKCS Seed DPA5 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 5
WH_CA 2
WH_SP 1
WH_XB Root 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|55168340|gb|AAV44205.1|| unknow protein [Oryza sativa Japonica Group]
Score 250
Evalue 3.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20834
AACAAAACATGCCCAGCAATCGCTTGGATGCGATGCGGTACTTAGGTACAAAGGATAAAACATCAGATATTAAATTGGCATGCTTAAAAGGTGTAAAGGC
AGCTCCCGTCGTCACTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAACGCGTTAGCTACAGCACTGCACGGGTCGAGTCGCAC
AGCACCTAGTATCCATCGTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGA
GTGCTTTCGCCGTTGGTGTTCTTTCCGATCTCAATGCATTTCACCGCTCCACCGGAAATTCCCTCTGCCCCTACCGTACTCCAGCTTGGTAGTTTCCACC
GCCTGTCCAGGGTTGAGCCCTGGGATTTGACGGCGGACTTGAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACGCTTGCATCCTCTGT
CTTACCGCGGCTGCTGGCACAGAGTTAGCCGATGCTTATTCCTCAGATACCGTCATTGTTTCTTCTCCGAGAAAAGAAGTTGACGACCCGCCTCGTGCCG
AAATCGACACGAAGGAAACCCTAGCCGCCGCCGTCCAGATCTGCTTGGGTTGGTGGAGGTATGGCTACGGCGCTGCGCACCATGGCCGCGAAGCTGATGC
AGAAGATCCCCGCCGCTGTCCAGCGGGTTCGCGTCTCTTCTCGTGCTCCGGCACCGGCTTTTGCCGACCTCGACCCCTTCGGCCCAGAGTTTCGCCGGGC
ACTGGAGAAGATTGTAGAGAAACACAGGAAGAGGCGCAGGAACGAGGCCTTGGCCTGTGGTGCTGGCTTCAGTCTTGGAGCACTCACCTTTTTGCTTGGG
GTCCATCGGCTTCGTTGAAGGGAGATGGCTCAATGGTGAATGACTGGAATATCTATCCTGCACCGCATGTTCTACTATCTACTACTGTGCCCGCAAGTTC
TACTATCTACTAGTGCTATATCCTGCACCCCATATGTTCTGCTATCTACCAGTACTATATCCTGTATGTTTAACTAGCCGGTGTACTCTATAATTCCTGG
CTTGTGTCTACCTATCTAGTAGCCACTGTGGGGATCTAATTTCGGTGGTTGCATGTGGGATGTAAGAGCACTCTATCG
page-top