Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20831  (registered. 2012)
Contig Information
Length 865 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|55168340|gb|AAV44205.1|| unknow protein [Oryza sativa Japonica Group]
Score 232
Evalue 4.00E-59
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20831
GAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGT
GGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGGTGGAACGGTGAAATGCATTGAGATCGGAAAGAACACCAACGGCGAAAGCACTCT
GCTGGGCCGACACTGACACTGAGAGACGAAAGCTAGGGGAGCAAATGGGATTAGAGACCCCAGTAGTCCTAGCCGTAAACGATGGATACTAGGTGCTGTG
CGACTCGACCCGTGCAGTGCTGTAGCTAACGCGTTAAGTATCCCGCCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGGCCCGCAC
AAGCGGTGGAGCATGTGGTTTAATTCGATACAAAGCGAAGAACCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAA
CGCGGACACAGGTGGTGCATGGCTGTCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGA
GTTTGGAACCCTGAACAGACCGCCGGTGTTAAGCCGGAGGAAGGAGAGGATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACA
ATGGGCGGGACAAAGGGTCGCGATCTCGCGAGGGAGAGCTTAACGACAACATGTGTTAATTATATATATCTAGCTAAGAGCTTTTACCATCTTGGCTCTT
ACTCTGGTTAAAGAAAGTTTTGCTTTAGCACCAATTATACAAGAAATTTTCCGTGAAAAAAAAAA
page-top