Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20825  (registered. 2012)
Contig Information
Length 585 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 1
Wh_OKCS Seed DPA5 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_SP 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig20825
CCGGGACGAACCCTAGCTAGGCTCTCCACATCGGCGGCGGCGGCGGCAGAGAAGAAGAAGATGATCTACGACGTGAACTCCCCCCTGTTCCGCTCCTTCC
TCAGCCAGAAGGGCGGCGCGTCCTCCGACAAGAGGAAAATGGAAGAGCAGAAGCCGAAGGACCAGAGGTTCAAGGCCAACGAGAACAAGCCTGTAATGAA
TGAATGAGCGTCGCCTGGACAGTCCGGTACCTGCAAGGCCTAGCTGCCAATCATGTGACTCCTATATGTTAAAATGAGTGGTGTGAACATTTGCTTGGTC
GTTCTGAGAACTATCCAAGTATCTAGTACTGTGTTTTAAGTTCCTACTAGCAAGATGCCCGTGCGTTGCACGAAACATCAAGATGCATTTGTATGAGTAG
TTTATCTTGTGAGAAAAAAATGATGAACGAGGAAAAGCCTTATTTGCAAATGTGGATAGGGGTGTGGGTATCTTTTTGCAAAATTGCCATAGTTTCCTTC
CTATCCGTCAGATATAAATCGGACGGCTTATATTGCAGGATGGCAGGCACACCATCATCATCAATTCTGTTTTTTAAAAAAAAAA
page-top