Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20815  (registered. 2012)
Contig Information
Length 2032 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|11993905|gb|AAG42149.1|| mitochondrial processing peptidase alpha-chain precursor [Dactylis
Score 880
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20815
ACTGTCATATTGAATCTTTATTCATTTCCTTGCGATCTTTATTCATTTCCTTGCGCCAACACTAGTTTGAACAACCACGTGACACATGTGGTAAGCAATC
CAAACAATTCAAAAACACTAGTTTCAACGACTTTAACCAAAAAAAGTGGAGGAACTTTTTGTACACCCTTCCGGACTGCCACCAGAAGAGGGCCACACAT
GCATGATTTCACTGAATTTACAGGAACATATCTCATGAGAACAACATCACACCACCCAACTCAGGTGGAAGCACGTTTTGCGAGGAAAAAAATAAAATCC
CAAAGTTGTCCCACAGTAGAGGAGTTAATGACCAAAATTGTATCCATCTTATTTTCCTTGTGAAAAATGTGACCATAGATGATCTTGGGAGAAAAAAATA
TGAACAGTTAATTTGTTCAGAAGCCTCCTCATTTCGAGCTGAACTTGCCACGCACTGTCTCGTAGGCTGGTACATTGATAACGTTTCCATGAGATGCCAT
TGTCAATGGTGACGAGATGATCTTCTCAGCAACACTTGATACATCTGCCAGTGTTATACCATCAACAGCCTTAAGAAGCTGCTCCACGGGTTTCCTTTCA
CCAAATGCCAATGCTTGGCGCCCCATGTCTTCAGTTGTTGATGCCTTTGATTCCAGGTTCTTCAAGATAACTGATTTTGCAGATGCTTTAGCACGGTCCA
GTTGGGTTTGGTCAACTTGACCAGGAGTAGCAAGGGAAGTGAGTTCTCTGGCTGCCAAGTCAATAACTTTAGGAACAAATGCTGCTTCAGTCGATGCATG
AATTCCAAAAATGCCAGTGTTACTGTGAACATTTTTGAAAGCGGAGATCGATTTGATTTGGTCAAATTCATTTACGAGGGGATTTAGGCGTGAATGCAAG
CCTTTTCCAGGTCTTCCCCAGGTAAACACGCCACCACCACCCAGAAGTGCCTGAAGAACAGATGCAGTAGCAAATTCTTTTTCTTTCAGCCATCCACCTG
GGAGCTCAAATGCCAAAGCAAGATCTGTGTTCGATGAATCTGCTGCCCGTCTATATTCTCCACCAACATAGACAGATTTTGGCTTTCCTGTTCCAGTTGC
AGTGGGAATGTCAGACAGGAGTGGTTCAGCAATTGATACAAGTTCATCATGGTCCACACCAGACGCAGCTAGAACAATTCGCGGGGAAGTGTAGTTCAAA
GCAAGAAATTCTTCCAGAACATCTGTATTTAATCTGCTAACTGAAGCCTCTGAGGCAATCAATGGGTTTGCCAAGGCACCAGAATAGCCACTGGAATGAA
GAGCATCCAAAAGGAAAGCTTCCGGATTACTTGAAGCTTCTGCAAGCTCTGCCTTTAGTTTCATTATCTCTTCCTTGACTTCCCAATCAAGTAAAGCAGG
ATTTCTCACACAATCAACTAGCACTTCCACCATTTCAGGCATGTAAGTCTTAAGGGCTCCATAGCTGTAGCTCATGAGCTCACGGTTGGCTGATGCTTTC
GCACTGCCACCTATTGCACCAATTTCACGAACAACACGCAACTGGCTCCTGTTTCTAGTGGTTGTGAAGGCCAACTTCTTTAATAACTGAGTGGCACCCA
GTGTCTCAGGTGTTTCATATACAGACCCACAGTTAACATAAACTCCAACAGAACATGCTGATCCTGGAGATGTTTCAGAGGCAATTTTTACACCATTTGA
AAGTGTTGTGATTTTTGTCTTGCCAGGCTCCACATGATCAGCCAGTGGAGGAGGAATAGTGACTCCTGGGAGTGCGAAATCTGGAGGGGGTAGTGCATTT
GAACGTGCACCTGTCAGCCAGCCCAAGAAGCCGCCCGATGACCTCTGTGCAATACTTGTGCTAGCAGACCTAACCGCGATATTCAACAGTTGGGTATCCG
CCCCATGCTGCTTGAGGGCGCCGAGGCCGGAGGCGGCTCGGTACATGATGGAGGACGCCTGTGAAGATCTGTCGACGGGGACGTCGCCGGCGGCGCGGCG
GGAGCGGCGGAGGGGGAGATGGGGACGGAGAC
page-top