Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20809  (registered. 2012)
Contig Information
Length 938 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|290875537|gb|ADD65763.1|| putative carbonic anhydrase [Triticum turgidum subsp. durum x
Score 379
Evalue 6.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20809
CAACCGTCGCGCCCCGTGCCCGCTCCTCCACCATCGNNNCCAGCCTCGGCACCCCCGCGCCCTCCAACTCCTCCTCCTTCCGCCCCAAGCTCATCAGGAA
CACCCCCGTCCAGGCCGCGCCCGTCGCACCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGAC
AAGAAGCCCGATTTCTTCGAGCCCCTCAAGGCCGGCCAGGCGCCCAAGTACATGGTGTTCGCGTGCGCCGACTCGCGTGTGTGCCCATCGGTCACCCTGG
GCCTGGAGCCCGGCGAGGCCTTCACCATCCGCAACATCGCCAACATGGTCCCCTCCTACTGCAAGAACAAGTACGCCGGTGTTGGATCGGCCATCGAATA
CGCCGTCTGTGCTCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCTCTGCTCTCACTCAAGGATGGCGCAGACGAC
TCCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGCTTCCCGGCCAAGAAGAAGGTGCAGACTGAGTGCGCCTCCTGACCTACCCGTTCGTCAAGGAGGG
TGTGTCCAACGGAACCCTCAAGCTCGTCGGCGGCCATTACGACTTCGTCTCCGGCAAGTTCGAGACATGGGAGCAGTAAATCTTCCCCAGCGGTTAACTC
CTATATATACATGCGAATGCAAACGCGTACATATATCAAGATATCGTCCGACCGACCGATGTGAATCCAATGCCATGGAGTGCGTACTCGTTGTTTTCCA
GTACTGGATGCCGGGATGGCCCGATGTGAATTCGCCATAAGCAATAGAACCCTTTTTCTTTTACCATTTTCTGACGAGGAATTGTACTACCATGTGATGC
ATAATTTGATCGTCCTGTGATCAAAAGACATCATATAT
page-top