Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2080  (registered. 2012)
Contig Information
Length 1271 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116309899|emb|CAH66934.1|| OSIGBa0116M22.1 [Oryza sativa (indica cultivar-group)]
Score 508
Evalue 6.00E-142
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2080
GAAAACCTGGCAAGTTTCTAAAGCTTTCTGGCATCTTAGCAAGACAGATAGTTTGCAGTAACACATGTAGCTTCAGCAAACAAAATGCATAATTTCCGTT
GCAAACAGTCTAATAAAGCAAGTATACCGAGTTTCAGCCCTATTATTATTGGACAGTAACACAACCGGGGCCTTCGATGGAAATGACCCTCAAATGGAGT
TAAAATGGGAAAATAAACGCCACCTTGGAGGGCAGGGGCTTGTAAGGCTGTGCATCTCTCTGAGTCGACAGGAACACAAAGTGATTCCCAGCTCGAGAGT
TTCGTAAACATGGTATATACATTCACGATACTTGATCACCTCTGAAACTGAGGTTTCAGAACTGCTGGTCGAGGATCGAGTCTTTCTCCGACTTGGTCTG
GCCACCACTGACATAGCCCACAAGGCTCCCCCCAACGTCCGAGACCCAGGAAACGCTGCGCGCCAGCCAAGCCTTGGGAGTCGACGCCTGCGGGCTCTCT
GCTGCCGCCGCCGCCATGCTCCTCTGTTCTTCCTCGAGCAATGCATCAAGCCACCTCTTTGACGTGTACTCTTTCACAGCGTCTACACCTTCCTTCACGA
CCTCCGCTGGTGGCATGGACAGAGGGTTCTGCTCCAGGTTAAGCTTCTCTAGCTTGTCAAGCCGGCCAAAACTGTCGGGAAGAGCATGGATCTGGTTGTT
GCTGAGGTCAACCTCGCGCAGGTTCAGCAGGTCACCGAATGAGAAAGGGAGCTCCTTCATGTCGCTGAAGTTGCTGCTCAGGTTGAGGATTTCAAGGCTG
GAAAGCTTCCCTATGGCAGATGGCAGACCGCAGAGTTCATTGAAATGAGCATCCAGGAGGTATAGTGATTGCATCTCACAGATAGATGATGGAAGAGATC
GCAGCTTGTTCATGTGGACCCAGAGCTTTCGCAGATTAATCAGTTCATAGCCAATATTTGTTGGCAGATATGTGAGCCCATTGTAGCTTGCATCAAGCTC
AACAAGCGACCTGCACTTTGAGATGCTGTCTGGCAGTGTTCGCAGCTTGTTAGTCGACACATTCAGAATCTTCAGATTGGACAGAAATCCAACAGTATCA
GGAAGAGAAACCAAGGCATTAGAAGCAAGACGGAGCTCTTCAAGATGATCAAGCCCCCCTATAGCATCTGGAATAACCTGGAGCTGGTTGTGTGATACGT
CAAGCACGCGGAGTCCCAGGATCCTTCCGAACGCCTCGGGCAGGTAGCGCAGCTGCCGATCCACGAGGAGC
page-top