Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20790  (registered. 2012)
Contig Information
Length 894 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115472639|ref|NP_001059918.1|| Os07g0545900 [Oryza sativa (japonica cultivar-group)]
Score 416
Evalue 1.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20790
TTGTCTAGAGAGCATTACAATTTCGACACCTTGTTCTACCTGACATGCTCGCATAGGACCTCGGAAGAACAATAGCAATCACATATGTCCAGGCGAGGCG
ACACTCATTGTTCATCCGAACCTATCCAGAGGACGTTTGCTAGGCCAAAGGTCCTGCCCTCCGCACACGAACACGCTCACCATTGAAATGGATGTACTTC
CACTTCTTCAAGTGTTTTTCAAGGACAGGCTTCTGCTTATCTTCCTGGCCTGAAGTTGCAAATGCTCGTCCGATTCTTCTTGTTGTATCCTCGTCTGGAC
GCACGCCCAATTCCTCCATGTCAGCATATATCTCCAAAACTTTGTCTGGAAGATGGCGCGTGTTGTAAATCTGGATCATCCGAGAGAACAACTTCTTGGG
CACTGAGCGTGTATAAGTTTCTAAGATAGTATTCCAAATTGACTCAGCCTCATCTACTCTTCCATCCATAGAAAGAGCCAACAGCAGTGTATCGTACGTT
GTCCATGTCAGCACCTGACCTTTACTCATCAGCCACTTGGTTACCTGGATAATCTGTAGCCATTTTCTTCGCTTTTTCAACATCTCCAAAGCTTTAGCCG
CTGCTATAATTGGAAATTCAGACTCAAAAGCGGTCCACCTATCCAATGCACCATAAACAGCTTCTTTTTCATTCGGTAGTTTTGAAACAGTATTAACAAG
ACAAAGAGCCTTCTTCCCTGACCCAGCCGAATCCTTCCTAATCCACAAACGGTGGTCCTTGTTTGGCTTCTTTGACACCAGCGCTCGGCTCGCCGTAGGG
CGACCACTTCCTCGTCCTCCTCCCCTCGTCGCACTCGCCACCGTCGGCGCCGCGAGGCGCGGCCCTAGGCGGAGCGCGAAGGGACCCGCCGCCA
page-top