Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20739  (registered. 2012)
Contig Information
Length 1045 bp
Clones alternative view 146 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 8
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 21
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 30
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 45
WH_SP 2
WH_XE Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|31753114|gb|AAH53854.1|| Unknown (protein for IMAGE:5194336) [Homo sapiens]
Score 525
Evalue 4.00E-147
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20739
CGTCTCAACCATCTCCACACTCTTCAGTTTTCATTGTTTGGAGAACACACAATACACCTCCCACCTTAGCAGCGCAATGGCGACCACCACCATGTCCCTC
TCCTCGACCTTCGCCGGCAAGTCGGTGAAGAACGTGGCTTCATCAGCTCTCTTTGGTGAGGCCCGTGTCACTATGCGCAAGACCGCTGCAAAGGCCAAGC
CGGTTTCATCAGGTAGCCCATGGTACGGTGCCGACCGTGTGCTCTACCTTGGCCCGCTTTCCGGAGAGCCCCCGAGCTACTTGACCGGCGAGTTCCCCGG
CGACTACGGATGGGACACCGCCGGGCTCTCGGCCGACCCCGAGACCTTTGCCAAGAACCGGGAGCTCGAGGTGATCCACTGCCGGTGGGCCATGCTCGGT
GCGCTTGGATGTGTCTTCCCCGAGCTTCTTGCACGCAACGGCGTCAAGTTCGGCGAGGCGGTATGGTTCAAGGCCGGTTCCCAGATCTTCAGCGAGGGTG
GCCTCGACTACCTGGGCAACCCCAGCCTCGTGCACGCACAAAGCATCCTTGCTATCTGGGCATGCCAAGTCGTGCTCATGGGCGCTGTTGAGGGGTACCG
CATTGCTGGCGGCCCACTCGGTGAGGTAGTCGACCCACTCTACCCCGGGGGCAGCTTCGACCCACTGGGCTTGGCTGACGATCCAGAGGCATTCGCGGAG
CTCAAGGTGAAGGAAGTCAAGAACGGTCGCCTCGCCATGTTCTCTATGTTTGGCTTCTTCGTGCAGGCCATCGTCACCGGCAAGGGCCCACTCGAGAACC
TCGCTGACCACCTCTCCGACCCTGTCAACAACAACGCATGGGCGTTTGCCACAAACTTTGTCCCCGGCAAGTGAGGCGTTGGCGCTCGCTAGCTGCGAGT
TGTAGCCATATATCAAGGCAACTGCGGTGAACTGCACACATAATGGGTGGTTCAAATTGTAACATCATGGTGTAAATTACAAGGATCTTTGGGGAAATGG
TTTGATCTGCCCGCTTGCTTCATGTCCTGGATGTAGCCTGTGTGT
page-top