Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20723  (registered. 2012)
Contig Information
Length 639 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_VWD Shoot grown with dessication 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242041669|ref|XP_002468229.1|| hypothetical protein SORBIDRAFT_01g042150 [Sorghum bicolor]
Score 226
Evalue 1.00E-57
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20723
ACGCAAATCTGTCTTCCTGGTTGAAATTTGTTTTTTCCACTTATTACAGACTTCAAATGTTTCTCTCGTGATCGAACCAAACGGTGGCTGCCATGTAGTA
CTCCCTCCGTAAAGAAATATAACAGTGTTTAGATCACTAACGGAGGGAGTACATCGCATTTCTGTAGTTAAGTTGCAGGATCATTTTCTTCCTGAATGCA
AATGGCTCCCAAGTTACTAACTTTTGTGACTGTTCACAACACAAAATTGTGCATTGGTGAACCATGGTGATGCAGTCAGTAGGGTACAGTGGCAGTGACC
GTTCTGTGCCTGGGGTCTGTCAGCACGGAGCACACATTGACGAAGCCTGCTTGGCTGAGCGCCTCCTCCAGATCCAGCATGTAGTACTCGTCCAGGAACG
GTTCGGTGCTCTTCATAAGAGTGAACAGAACGGGTGATAATTCCTGGAGTACTTTTGATTTTGGTGAGTTGTCGGTTAAGGCGATGGTTCCTCCTGGACG
AAGCAGTCTGAATGCTTCCTTCGCCAATCCGATTATTGCTCGTGCTGGACACTCGTGGCACACATAAGCAAGGGAGACGACGTCAAATGAATTCGGTGGC
AACCCAGTCGCTTCACCATTTGCATGAACCCAACGAATA
page-top