Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20719  (registered. 2012)
Contig Information
Length 627 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_KMP Shoot grown under continuous light 1
Wh_RDr Root of dessiccated seed 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058699|ref|XP_002458495.1|| hypothetical protein SORBIDRAFT_03g034720 [Sorghum bicolor]
Score 144
Evalue 7.00E-33
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20719
TTTTTTTTTTGTTAGAAGGCCACACACTCGCCTGATATTACTCCCCATTTGATCCAAGCATAAATAACATCGCATAACACAAATATTCACCTCAAATTAA
CCAAATCAGACTTCTCAGGTTTCAGCAATTGCAAGAACAGCATTTCATTACATCTTATTTAACACATATCGCACAACATGTGAGAACAAAATACTCCGGT
CTGACTACAACAGTACGGGAAACAAACCGAATGGAGATTCCTTCTCCCTGACCGAAACCCTGCAGACGGCTCGGAGTCTCGACATCCACCGGAGGCGACG
CTCACAGGAACTTCCTGTACGGCCGGCCGGCGTCCTCGTCCTGCATATGGAATTCGCGAACGATGCCCTTGTAGACGAGGATGGGGACGGCGAGGCCGAA
GAGGCCGATGACGGCGAGGCTGCGGCGGGTAAAGCGGAAGTTGAGCTCGAGGTTCTCCCGGCCGGCGTTCCACTCCTCGATCCAGCGGTTCTTGTTCACC
TCCATGCCGCCACCCATCTTCTAGTCTCCTCTCCTTGATCCGCCGCCTCCTGCTTCCTCTCCGCTCTCAGAATGTGCCGATGGGCTCGCCGAAGATTTGG
TCTGGTTCCTCGTGCGTGGCCTCGTGC
page-top