Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20715  (registered. 2012)
Contig Information
Length 960 bp
Clones alternative view 75 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_r Root 1
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 3
WH_XN Leaves, plant was grown at constant 23Ž 8
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 7
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110628146|gb|ABG79538.1|| putative E2 SUMO conjugating enzyme [Triticum turgidum subsp.
Score 347
Evalue 2.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20715
CACGCTGGGGCAGAGGGGGTGAGCCCACTCCCCCTCTCTTCTCCTACCACCAGCAGAGATGGAGAACAGAGCAAAACAAATGCTTTGCTAGGATACAGAT
TAGAAAAATGACAGAAACATGGCACATGGCAAAATGTTATATTGCAGCCAACAGACGCATTTAGAACCGACTAGTACCGCACACGGCAATCCACCTCAAG
ACAGACATTTAACCCACAAAACAAGCACTTAGTTCAGGGATCACCGTTATGAAACCCGACTACAACCAACACGGATCTTAAGTCGAGACTGGTCCACAAT
GACAGACGATGAATACTTCTCAAGGCACCCTTTTCCGGGTTGTACTTGGTCTAACTCCATATATGCAGAGGCATTCATTTTAGATCTACTTCCAATAACT
ATGCGGATGTGCAGAGCATGGATCATTAAGCTTGCCAATCCTTCCTCTCAGACCAATGCGGGATACTGCTTTGCCTGCACCCGAACACGCCTCTTGTACT
CAGCTGGATCCTGGATGAAAAGGTGATAACCATCAGTCTGGGCAGGGTCAGCCGGGTTTGGCTGATCAAGCAAGTCCTGAATTCCAACAAGGATTTGCTT
CACAGTAATAGCAGGTCTCCAGCCGCTGTCCTCATTGAGGATTGAAAGGCAGACTGTCCCCGAAGGGTAGACATTCGGGTGGAAGAAGTTCGTAGGGAAC
TTGCACTTGGGAGGCTTGCTGGGGTAATCCTCGCTGAAATGAAGGGTGAGAGGGAAGTATCCACCTTCCCAATCAGTCCCTTGCTTGCCGGGGATGGTGC
AGTGCCAGACCATGAGGTTGACCGTGCCGTCGCCCAGCGTCTCCGGCTTGGCGACGAAGCCGTGGGGGTGGTTCTTCCGCCAGGCCTTGCGCTCCTCGGC
GAGGCGGCCGCGCGCGATCCCACCGGAAGACATGGCGGCGGCGGCGGTGGACTCCGGCTG
page-top