Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2071  (registered. 2012)
Contig Information
Length 829 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_SP 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|215695507|dbj|BAG90698.1|| unnamed protein product [Oryza sativa Japonica Group]
Score 338
Evalue 6.00E-91
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2071
ACTTCAAAGAAGCCATGCATCTCAAAATTTTGGCGAACATACGTCGTGGCAATTCACACGTCCACTTTTGAGTAAAGAACCCCGTAAAGAGCCCGTGCTT
TCAAGTGCAAGGAATTACAGGCACCTAACTCCGAAGAATGCGGCTCATTGTGTAGTAGCAGAAGCTCCATGCGATTTTCAGGACAAGGGGGAAATGGGAG
TAAATTGTGCCAGTATATGTGTATCTTCTTTGTCTACTTCACGTATGTGTAACTATGTGGGAACCAGCTTTCCAGGAGAGATCTCTTGATCCTCAGGACT
AGGGCGAAGAGGCCATAACAAGGGAAGTGAAGCAGTGCCACCACCAAGTACCAGACAGGTGCTCGAGGGTATGTCAAGTCTAGGAATGGGTAAGGCCACC
AAATCGACACATTAGCATGGATGATCCACTGAACACTGACAAAAAGTCCTGTCCAGAGCATGAAATATGATATTCTAAACCATGGAAAACGCAGGCTATT
CAAAGCAGTATCACCGATTATGAAGAGAGCATTGAGTGAATGTGTTCCAATCAGCAAAAAATTCATTTGATACTGATTCCGGGCAAGAAAAGGGTAGAGA
ATGAACCAAAACACCATATCCGTAAGCATCACAGCACCTGCATTTGTCTGAAACATAATCTGGAACAGATAACCCCAAAATCCTGCAATTTCCCGGCCAT
TATGTGTTCTATTGAAACAAGAACTTTTGATGGAATCGTCGTATGTACTTTCCCCCGTTGGAGCAATGATATAAGAGCCATGATCTCCATCNNNNNNNGC
CGTCTTGCACGCGTACTGATAACATCCAT
page-top