Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20697  (registered. 2012)
Contig Information
Length 1532 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|208609045|dbj|BAG72145.1|| alpha-glucosidase like protein [Hordeum vulgare subsp. vulgare]
Score 838
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20697
ACATTTGGAATGACATGAACGAGCCATCAGTCTTCAACGGCCCTGAGGTCACCATGCCTAGGGATGCATTACATAATGGTGATGTTGAACATCGAGAACT
GCACAATGCATATGGGTACTACTTCCATATGGCTACATCAGATGGGCTTCTCAAGCGAGGTGAGGGTAAAGACAGGCCCTTTGTTTTGTCAAGGGCCTTC
TTTGCTGGAAGTCAACGGTATGGGGCAGTTTGGACCGGTGACAACACTGCAGATTGGGATCACCTTAAATCTTCTATTCCGATGGTTTTAACTCTTGGTC
TTACTGGCATGACCTTCTCTGGTGCGGATGTTGGTGGATTCTTTGGCAATCCTGAGCCTGACCTATTGGTGCGTTGGTACCAAGTAGGAGCTTTTTATCC
TTTCTTTAGAGGTCATGCTCACCATGACACCAAGAGGCGGGAGCCATGGTTATTTGGAGAGCGAAGAACTGCCCTCATGAGGGAGGCAATACATATGCGG
TATTCATTGTTGCCCTACTATTACACTCTGTTCCAAGAGGCTAGTGTAACTGGTGTTCCTGTTATGCGTCCTTTGTGGTTGGAATTTCCTGATGACAAGG
AAACATATAATAATGGTGAGGCTTTTATGGTTGGGCCAAGCATTTTGGCCCAAGGAATTTACGAAGAGGGCCAGAAATCAGTGTCGGTTTACCTTCCTGG
AACGGAGTTATGGTATGACTTGAGAAATGGATCACCATACAAGGGAAGTGTGTCACACAAGCTGCAAGTTTCAGAAGATAGCATACCAAGCTTCCAAAGG
TCAGGCACAATTGTGCCAAGAAAGGATAGATTCAGGCGCAGTTCTACTCAGATGGTGAACGATCCATACACCCTGGTGATAGCCCTCAATAGCTCGGGTT
CTGCAGAAGGTGAACTTTATGTGGATGATGGGAAAAGTTATGATTATCAGCAAGGGGCATTCATCCATCGGCGTTTTGTATTTGCAGACAATAAACTAAC
TTCAATCAATATTGCGCCTGATAGTCTGGGCAAGAAGGTGTATTCAACTGAGTGTGTGATTGAAAGAATTATAGTGCTTGGGTTATCATCGGGAGCAAAG
AAGGCTATCATTGAACCTGGGAACCAAGAAGTGGAAATTGATCTGGGACCGATTAGTTTAAGGAGTGGTTCAAAGTCTGTTGCGCCAACAGTCAGGAGGC
CCAATGTTCGTGTTGTAGATGATTGGACGATAAGGATCGCATGATATGCAGCCCATTCACATCTGGAGCCTGATGTCTCCATTGTTCGCTGTCAGGCTAT
AAACTCGAGCAATGCTAGAAGCGTAGTTTCAGACTCGTAAATGTTATCTGTGGACACCCAAATTTCATTGTTTCAGACTTCCAGTGGACCCAAAATTTCT
GCAGGTGCCTGGTACGCATGCTGTTTGTACTCCCAATTTTGACATAAGTCGTGACATAAATTGCTGATGTATACCTGTAGCACTTATACTGAAATTGGTG
TGCCACGTATGATGTATGCGATATGAAGTTCT
page-top