Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2060  (registered. 2012)
Contig Information
Length 1116 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 6
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig2060
TTTTTTGCTTCAGAACAGTTTTTTTTTTAGAGGAAAGGCATCGGCCGAGCCCAAGAGGAGGCTCGAACCTAGCCCGACTTTGAATTAACAAAGCCATCAA
CCGGTCAGGATTACATCGATCAACCACATACATGCAACATGAAAAAGAAAGAAAAGGAAGACACTGAGGCAGAACAACCTCAGGCGGCCGATACAAGGTG
CAAAACAGGACAGTGCACAAACCAAAGACTACACAAGCAGCTACCAAGATGAAACTGAAGAACTAAGCTTGAGCAGTCAAGGTCTTCGTCCACCGAAGCA
ATCAGCACCGGACAAACATCAAACTTGTGGAAAGCAACAATGTGAAAGGAGAAGGCTCAAGTCCACTCCAGCATGATGAACAACCTGGGCATAATGAAAT
CCGTCTTCGTTGCCGTAGGAGGCCACAACCTTCTCGTCGTCGGCAGGCGAAGTGGTTCCCCAAGAACCCGAATTCACAAATGGCAACCAGATGTATCATG
GGAGGGGCTGCAACAGACCACATTGTGCTCCACAAGAAACTTCAGTTGCCATGGCACAGCCACGAAGGAGACGCGCACTGCAAGATAGGAACGCGAACTA
AATCGACACGGCGAGAGGTTGATGAAGAGCAATGCCGCCACTGCAGCCACCAATACATCCAAACTCGACATCCACCCCGCAGTACAAGGACGGCGCCTTC
AGGAAGGGGAACAGTGCCGTAGCGGCGCCGTCGTCCTGAAATAGGACCAAGGTTTTCACCTAGATGCAGGGGCAGATGGGTGGGGGGTGGGATACCTCAA
CGAAGCCTCCAAGAAGTAGTTCGACGCCGCGGCATCGTCGTGGTTGTGGCCGCCGGCGGCGGCCAAGGGTTTCCCCCGGTCCCAGGAGCCCCACCGCCAA
AACACCGGCAACCACCGGATCCGGCGAGCAGGGCCGCACCGGAGCTGAGATCGAACGGGAGAAGGTGAGGAGGGTGGATTTGGAGCTGGCCGATTCAGAT
CTGGAGGCCGACCGACGGAGGAAATCCGGCCACCGCGAGCTCCATCCACCGGGGCCTCGCCGCCCAAGCAAGCCGAGGAGCCCAGCCGAGCACCCGCAGC
CGCCTGCAGCCCGGGG
page-top