Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20575  (registered. 2012)
Contig Information
Length 939 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 3
Wh_RDr Root of dessiccated seed 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|290875537|gb|ADD65763.1|| putative carbonic anhydrase [Triticum turgidum subsp. durum x
Score 329
Evalue 7.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20575
TTTTTTTTTTGATGAAAATATGAATGAAATTGCATCTGATGTCTTTTGATCACATGGCGATCAAATTATGCATCACATAGTAATATTTGTACAATAATAC
CGCATCGGAAAATCTGACCCCTTATTACAAAATTGACATCCAGCCATCCAGCGTTCACTACTGCTGGAAAATAACGAGCAGGTGCATGCTCCATGGCATT
CACATCGATGGATCGGTCCCACGGTATATTTGATATGATATATGTACGCATGTATGGATCTGTAGGAGATGAGCGATGGGTGGCGAGATTAATTTACAGC
GCCCATGTGTCGAACTTGCCGGAGACAAAGTCGTAGTGGCCGCCGACCAGCTTGAGGGTTCCGTTGGCCACAGCCTCCTTGACGAACGGGTAGGTGCTCA
GATTCTGGAGGGACACGTTGACGGCCTCCTTTTCCAGGACACCGCACTGCTCCTCAAAAGGCATCTCGGAGCACTCATCCTTCACCTTCTTCCTGGCCGG
GTACCCGATCCTGACCCAGTCCTCCACGAAGTGGAAGGTGTCATCGGCGCCGTCCTTGAGGTTGAGGAGGGCCTTGATCCCACCGCAGCGGCTGTGTCCG
ATCACCACGATGAACTCGACCTTGAGGGCGCAGACGGCATACTCGATGGCCGACCCGACACCTGTGTGCTTGTTCTTGCAGTAGGATGGGACCATGGCGG
CGATGTTGCGGACGGTGAAGGCCTCGCCGGGCTCCAGGCCCAAGGTCACTGAGGGGCACACACGCGAGTCGGCGCACGCGAACACCATGTACTTGGGTGA
CTGGTGGGCCTTGAGGGGCTCGAACAGATCCGGCTTTCGTAGACCTCGGTCTTGAACTTCTCGAAGCCGGTCTTGAGGCGCTCAACGGCGGGGTCCATCT
CGAGCAGGGAGGGTGGGGGAGGAGGTGAGGAAGAGAGAG
page-top