Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20551  (registered. 2012)
Contig Information
Length 841 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 10
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 5
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|462081|sp|P00228.2|FER_WHEAT|FER_WHEAT RecName: Full=Ferredoxin, chloroplastic; Flags: Precursor"
Score 283
Evalue 2.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20551
TTTTTTTTTTCCCAGGTAAGATGTTCATCAAGTAATTCAGCAGTCTCTTAATTAAAGAGAAGATATTATTAATCAGAGAGACGCCTCAGCCATCAGGATT
CATTTCAGTACGTCGAGTTACGTACAAGGTACACGCTAGTATTACGGCAGTAGTATATCTTACGGTACAAAAAGGTAGTAATTCGAAGACATTATTACTT
GAGCAAACCATGCATCGAGCAATTCATTCGAGCACAAACAATTCGGTGTATCTGGCAATGTCCGTGCATGCATGAAATCAGCTCTCAGGGTTTACACAGG
TCTCAGGGTCCGTGATATTATCTTGCAAAGAGAGATAGGTAAAGCAGCTTATGCGGTGAGCTCCTCCTCCTTGTGGGTCTCGATGACGATGTCGGACTTG
GGGTAGGCGTGGCAGGTGAGCACCCACCCTGCCTCCATCTGGTCGTCGTCGAGGAAGCTCTGGTCGGACTGGTCGATCTCGCCGGACACCAACTTGCCGG
CGCAGGAGGAGCAGGAGCCGGCGCGGCAGGAGTAGGGCAGGTCGATCCCCTCCTCCTCGGCCTGGTCGAGGATGTAGACGTCATCGGGGACCTCCAGCTC
CACCTCGCCCTCGGGCGTCACCAGCTTCACCTTGTACGTCGCCTGGGCGCGGAGCCTGGCTCCCCGCACCTGCTTGGCGGCGGCGAGGCTGAGGGCCGCG
GGCGCGAGGGCCACGCGGGGCGCCGGTGGCGCCACGGCGCGCAGGGAGAAGGGCGCGCGGAGGCTCAGTGCGGCGGCCATTGCTAGCTACCTAGCCGGAG
CTAAGATGCTCTAGGTGTGGCTGAGGAGGTGGAGAGCCCGG
page-top