Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20515  (registered. 2012)
Contig Information
Length 777 bp
Clones alternative view 107 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 9
Wh_f Spike at flowering date 5
Wh_oh Pistil at heading date 3
Wh_r Root 5
Wh_yd Spikelet at late flowering 2
Wh_SH - 2
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 5
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 5
WH_XA Root 5
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471704|gb|AAW50983.1|| ribosomal protein L11 [Triticum aestivum]
Score 359
Evalue 2.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20515
ATCATAAGACAAACATATACTCTATTGTTCAGAGAGGATAAAACAGAAGAGAGCCTCTTAGACGAAAGTGCGCATCAAACAGAAATCATCCAGCTTGAGT
ACAGGCAAAACTGACAAAGCATTTTTGGTTTCTAGGTAACATACATATCCAGCAACCAGGTGAACTTAATTAACTCAAGGTCTAAAGAGAGCTACGTCCT
TCTTAGCTCGCATGGGACTTGTTGAGGATGACACCCTCATACTTGACCTGGAACCACTTCATGGCGTCCTCCTTGGTGACCCTCTGGTGGATACCGACAC
GGGCCTTGCACCTGCGGCGGCGGGAGACGCGGTACCCAGCACGCTCGAGCACCACGAAGAAGTCCATACCGTAGATGCCGGTAGATGGATCATACTTCAT
GCCGAGATCGATGTGCTCCTGGATACCGAAGCCAAAGCAGCCGGTGTCGCTGAAGTTCCTCCTGAGCAGCTCGTACTCCTTCACCTTCAGGCCACTCTCC
AGCAGCTGCATCGCCTTCTCACCCCTGATAGTCACGTAGCACGCAATCTTCTCATTACGCCTGATACCGAACGACCTGACAGTGTACCTCGCCTTGGAGA
ACACAGGTGACTGTCCGCTCAGCTGCTCCAGCACCTTGGAGGCGCGGGTGAGGCGATCTCCGCTCTCGCCGACGGAGATGTTGAGGACGAGCTTCTGCAC
CTTGATGTCCCGCATGGGGTTCAGCTGCTTCTTCTCCGTCGACATGGCAGCGGATCTGGGGAGCGGCGGCGGGGGGG
page-top