Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2051  (registered. 2012)
Contig Information
Length 779 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 1
WH_XN Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|255673712|dbj|BAF06260.2|| Os01g0764900 [Oryza sativa Japonica Group]
Score 498
Evalue 3.00E-139
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2051
GCTCTGAAGGTACATAACAAAACATGGCTCCCCTGACTCCCAGACTTGTGGTGCCCATAGATGTGAAGAAGAAGCCATGGGAGCAGAAGGTTCGTCTCCA
TAACCGCTGGCATCCGGATATCCCTCCTGTTGCTGATGTAACTGAAGGGGAATTATTCCGTGTTGAGATGGTCGATTGGACTGGAGGACGGGTTAGAGAT
GATGACTCTGCAGATGATATCAAATTTCTGGACCTCAAAATTACTCATTATCTCAGTGGCCCCCTTAGAATAGTTGATGCTGAAGGGGTTCCAGCTTCAC
CTGGTGATCTTCTTGCGGTAGAGATCTGCAACCTCGGTCCGCTCCCTGGTGACGAGTGGGGTTATACCGGAATATTCGAAAGGGAGAATGGAGGCGGGTT
CTTAACCGACCACTTTCCAAGTGCAAGAAAAGCCATTTGGTATTTTGAAGGAATTTATGCATACTCCCCTCAGATACCAGGTGTTCGGTTTCCGGGATTA
ACTCATCCTGGTATAGTGGGAACTGCACCATCAGTTGAGCTTCTTAATATATGGAACGAAAGGGAAAGAAAATTGATTGAGACAGGTCACGAGTCTCTGA
AACTGTGCGAAGTTCTACATCAGAGACCCCTTGCTAACTTACCAACCTCTGATAACTGCTTACTTGGAAAGATTCAAGAAGGGACTGCTGAATGGCAAAA
AATTGCAAATGAAGCAGCAAGAACTATTCCTGGAAGAGAGAATGGGGGGAATTGTGACATAAAGAATCTAAGCAGAGGT
page-top