Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2050  (registered. 2012)
Contig Information
Length 665 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242091894|ref|XP_002436437.1|| hypothetical protein SORBIDRAFT_10g002570 [Sorghum bicolor]
Score 199
Evalue 2.00E-51
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2050
TTTTTTTTTTGCAGCGCCATGTGCAGAGCACACACCGTCAATTTTTTGTAATAATAAACATCACCTCTGTTGTGATTATTATTTTTGAGCTGCATCAACA
TTGCTCTGTATTTTACCATAGGTGGCAATAACATGCTACACATTAGACCAGGTCAGGTGCCACTCCTTAGTGCAGATTCATGTTCATATATACACTGCCA
CACGAGGGAGAAAATTGTCCCGTGTGACAGCTACTTCTACAGAAACATCCTGAACCAGGCTATCTCCTGATCCGTTTCGAGGCGGTCTTGGCTAGAGCAT
TGTAGATGTCGCGCTTCCTCTTCGCGTTTTCGTCGGTCTTGCCAGGGGCCGCGGCTGCGCTGGCCTGTCGCTCCAACGCTTCCCTCACAAAGAACTTCAG
CCTCCAGAGGGTCGTCTCGCTCTGAGCATCCATGTCAAGGTCCACTTCTTCTGCTGTAGTTTGGAAGTCAGGATTGTCTTGTGCGACCAGCTCCAGTGCC
TTGCTAAGATCTTCCGGGGTCAGGTGGCAAAGGCCTGCACCGAGTTTTCTCTTCTCGTCTGTGGTCATTTTTCTGCATCTCTGAACCACCATGTTCCGAA
GCTCCTCCAGCTGCTTATTAATCCTCGTGCAGCTCATCATCAGTATCTTTTGCTAATTTTGCAAT
page-top