Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20488  (registered. 2012)
Contig Information
Length 752 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|46798907|emb|CAG27307.1|| membrane related protein [Oryza sativa (japonica cultivar-group)]
Score 238
Evalue 5.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20488
GTAGCCCCTCCAAAATATGAGCCTTATTCATTGCAGTACATCATCATAATGATGATGGCCATGTCTCAGCATCCAATACAATTCAGTCTCATTATCATCA
TGGTTCTATATCCTAATCAGCTCTAAGCTTCACAGACTGCAGCTACAGCAGTATGTACACAAAAGCCTGCTTACAGACGCTTTCTAGCATGAGCAAACGC
CGTCCTCGTCCTCATCTGCAAGCGCGAGCGTCTCAGGACCGAAAACAATTATGCCGGATAGCGTCGCTCGGTTGTGCATCAGAACAAATGCGCGTCATGG
ATCGTCGATGTTTGGTTCCTATCTTCTTCCTGGTCCTGCAAACCTTCTCGCCGTTCCGAATACGAGGGCTTTGGTCAGTAGCCCCTTGTCGAAGGTGCAA
GCCAGGGCGACCACGCTGCCTATCACGAAGACTTTGGGTAGGTTGCCCGTCCAGTGCTTTGGCTTCTCGGCTTGGGCGTTGTTGCTGGTCGAACCGGCCT
TGGTGTTGTTTTCTGAAGCGGTGAGCTCGTCGGCGACAAACTTTGTGTTGGCGTGTGCCATCGCAGCGCATTTCGAGATGGGCTCCCCGGCGGCCCTCGC
GGTCTGGTATGCCCGCAGGCCAGGCTCTATCCGTTTGACGCAGCCCCACATACCCTGCTGCACGCCGAGCTTCGCGATGCTCCATGGGATACCCATGTCT
TCGTGATGAAACANNAGCACCTCGCATGCCGTCATCGCACCATCACCATTTC
page-top