Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2048  (registered. 2012)
Contig Information
Length 1346 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242038297|ref|XP_002466543.1|| hypothetical protein SORBIDRAFT_01g009680 [Sorghum bicolor]
Score 476
Evalue 4.00E-132
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2048
CTTGCGCACCGAGACGGCAGGAGGAGGAGGAGGAGAGCGCCGTCCAACTCCCAGCCAGCGCCGGCCAGCTCCTTCCTCGCCGCCGTTCCGTGGGTGATTC
CCGGAGCCTGAGTTGCCGAGGTGCAGGTCCGGTTCGTCTTCTCCCCGGGGCTTCTTCTCCTGGTTGAACCTCAGTAAGTTGAAGACAACATGTTTCGTAG
GAAGCACACTTCTCATTTCAATTCAGATGATGCTGAGCAGCGACAAGCAAAGATCAACGAACTGAGAGCTGCACTTGGGCCTGCGTCTGCCCGTGGCGAC
AAGTACTGCAGTGAAGCATGCTTGGCTAGGTATCTCGAAGCCCGCAACTGGAATGTTGACAAGTCTAGGAAAATGTTGGAAGAAAGTCTCAAGTGGAGGG
CAGCTAGCAAGCCTGAGGATATTCGCTGGCCTGATGTTTCTGTGGAAGCAGAAACAGGTAAAATGTACAGGGCAACTTTCACAGATAGAGAGGGGAGAAC
TGTCGTTATTATGAGACCTGCAAAGCAGAATACATCGTCTCATGAAGGGCAGCTTCGGTATCTTATATATACCTTGGAGAATGCAGTTCTCAGCCTGCCT
CAGGGTCTAGACAAAATGGTGTGGTTGATAGACTTCACAGGATGGACGCTGGCCAATGCAACCCCCATAAAGACTGCCAGAGACAGTGCAAATATCCTGC
AAAACCATTACCCTGAGAGGCTTTCAGTTGCGTTTTTGTTCAACCCCCCAAAAGTATTTGAGGCTTTCTTTAAGGTTATAAAAGTATTCCTTGACCCGAA
ATCAATCCAGAAAGTCAACTTTGTTTACAAGGACAACGAGGAAAGTATGAAGACCATGTACAAGCACATTGATCCAGAAGTCCTTCCGGTGGAGTTTGGA
GGGAAGAACATTGTGGTGTACAACCATGAGGATTACTCTAAGTTGATGACAAAGGATGACACCAAAACAACAAGCTTTTGGGCAGCAGATGGTAGCCATG
CCGTAAACGGGGGCTCGGTGCCTCAGGTCATACCGCAGTCGTCACCGATTGTTGCTAAAGCAAGTTGAGGAACATCGGCGAGCCATCTCACCTGTTATTG
CAAAAGTAAGTTGAGGAGCTTCAGCGAGCCAATGTGACGGTTCACAGCTCTAAAAGAGGAATATATATATCGATACGTTGAGGATGCTTGGATAAATAAA
TGTAACTGCAATATCTTGCATGTGATGTTACAAAAATAGTTATTACTAGTATATCCCCAAACAAGTGATCTCACAACAGTTCCATATTCCGTTGGCCAAT
AATTTGAAACACTAAAGAATAATTCACTTATTATTTAAAAAAAAAA
page-top