Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2046  (registered. 2012)
Contig Information
Length 600 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242090295|ref|XP_002440980.1|| hypothetical protein SORBIDRAFT_09g018230 [Sorghum bicolor]
Score 117
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2046
TTTTTTTTTTGAAGTAATTTCCATATTTTCCATTTCAAGGCAACATTATTCCATTACATTAAGATTGCCAAGTAAACAAGAGCAATTACAGGCTTACAGC
TCACAAGGCAAGGACACCTTCACAGTTTACTAGATGCGCCAAGATACTTGGAATAGCGGGCTTGAGCGATGATTTTGCCAGATTTCTTCTTCAGTTCCAC
AGTGGCCACTCCTACTGCTTTTCCAGCACGCAGAACCTTGGCCTCGATATCAATCTCTTCATCCGAAAATGCAGCATCCAAGTATGAGATGTTCATCTCT
AGTGGTGAGCCCTGGTTTGTGCCCCGGCCGTGTAGAAGACAGCAGTACCCACCAAGTCAACCAGCGACGCGGTCGCGCCGCCGTGCAGGAAGTTGCCCGA
GTTGAGGAGGCGGGCGGGGACGGTGAAGTGGCAGAGGAGACGGCCGGGCTCGACGGCGTGGACGCGGATGCCGCAGAGCAGGAAGGCGTCGTAGAACCCG
GAGGGCAGCGCGTCCACCTGCTCCGTCGGCAGCGACTCGGCCGCCGCCTCCTCCAGCAGCTGCCGAGCCTTCTCCAAAGCCGCGGCACGAGGCCTCGTGC
page-top