Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig20458  (registered. 2012)
Contig Information
Length 584 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|133741920|gb|ABO37956.1|| unknown protein [Triticum turgidum]
Score 139
Evalue 2.00E-31
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig20458
TTTTTTTTTTGGAAAATTGAGTACACACATCTCTTTATTAATCAAGAAGCTACATACGCGCGAGATTGATTACGCATGGCAACAAATAAACATGATCCCA
TGTACTACTACAAGTAGTTGCAAGCAGCAAGAACAGAACAAAACGAAACAGAGAGGCAGGAGTCAGATGGATCGGATGAAAATTGGAAAAAGGAAGAAGG
GGAACAGCAGCTTAATTGGAGCTGGCCGGCCGGGGTGATCGAGCTCCGCCGGTCTCTAGTCAGTGGTGATGTGCACGCCGATGACGATGACGAAGAGCGC
GATGAGGGCGAAGTAGATGATGGCGTGGACGAGGATGGCCATGGCGCTGGTGTGCATGTTGCCGAACTCCACGAAGTGGTGCTTCCCGGGGAGCTGCAGC
AGCAGCCCCGGCGACAGCAGCACGAACAGCACCACCGCGATCACCACCGGCCCCCAGTCCGACATCCTCCCCCTCTTCTCCAACGCCGGCGAGCTTCTTT
CTTTCTCTCTTTCTAGCTAGCTCCTCGGGGAAGAGAAAGGAAGGCAATGGAGCAGAGCAAACCAGGAGCAGCGGGAGCAGAGGA
page-top